EMAIL THIS PAGE TO A FRIEND

WBP2

WW domain binding protein 2

Synonyms: WBP-2
UniProtKB ID: Q969T9, O95638
Gene ID:
Human(23558) Summary: The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein, which binds to the WW domain of Yes kinase-associated protein by its PY motifs. The function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Mouse(22378) WW domain binding protein 2
Rat(192645) WW domain binding protein 2
fruit fly(39460) Wbp2 ortholog
domestic cat(101081588) WW domain binding protein 2
dog(608477) WW domain binding protein 2
chicken(417368) WW domain binding protein 2
Zebrafish(325287) WW domain binding protein 2
naked mole-rat(101701201) WW domain binding protein 2
domestic guinea pig(100719917) WW domain binding protein 2
cow(507060) WW domain binding protein 2
sheep(101108404) WW domain binding protein 2
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012478 Rosetta Predictions human pricing
NM_138975 Rosetta Predictions rat pricing
NM_016852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246010 predicted 367
2 SASI_Hs01_00246011 predicted 1264
3 SASI_Hs01_00246012 predicted 204
4 SASI_Hs01_00246013 predicted 1028
5 SASI_Hs01_00246015 predicted 319
6 SASI_Hs01_00246016 predicted 1006
7 SASI_Hs01_00246018 predicted 804
8 SASI_Hs01_00246019 predicted 311
9 SASI_Hs02_00344391 predicted 538
10 SASI_Hs02_00344392 predicted 259
11 SASI_Hs01_00246014 predicted 282
12 SASI_Hs01_00246017 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050116 predicted 214
2 SASI_Rn01_00050117 predicted 253
3 SASI_Rn01_00050118 predicted 251
4 SASI_Rn01_00050119 predicted 416
5 SASI_Rn01_00050121 predicted 347
6 SASI_Rn01_00050122 predicted 253
7 SASI_Rn01_00050123 predicted 234
8 SASI_Rn01_00050124 predicted 348
9 SASI_Rn01_00050125 predicted 422
10 SASI_Rn02_00268408 predicted 420
11 SASI_Rn01_00050120 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085571 predicted 1295
2 SASI_Mm01_00085572 predicted 1088
3 SASI_Mm01_00085573 predicted 934
4 SASI_Mm01_00085574 predicted 1231
5 SASI_Mm02_00323629 predicted 354
6 SASI_Mm01_00085575 predicted 948
7 SASI_Mm01_00085576 predicted 284
8 SASI_Mm02_00323630 predicted 299
9 SASI_Mm01_00085577 predicted 457
10 SASI_Mm01_00085578 predicted 391
11 SASI_Mm01_00085579 predicted 955
12 SASI_Mm01_00085580 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012478
WBP2 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012478.3-153s21c1
Sequence:CCGGCGGCGGAGTGATCGTCAATAACTCGAGTTATTGACGATCACTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012478.3-204s21c1
Sequence:CCGGCGTGGAACTCACATTCAATGACTCGAGTCATTGAATGTGAGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012478.3-1039s21c1
Sequence:CCGGGAACTAGCATTGTGGGACATTCTCGAGAATGTCCCACAATGCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012478.3-1800s21c1
Sequence:CCGGCCATGAAGTGAGGAGATGGTTCTCGAGAACCATCTCCTCACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-264s1c1
Sequence:CCGGCATGAAAGACTGTGAGATCAACTCGAGTTGATCTCACAGTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-237s1c1
Sequence:CCGGGCAGTCCTTCATGATGCCATTCTCGAGAATGGCATCATGAAGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012478.2-136s1c1
Sequence:CCGGGACATGAAGAACGTGCCAGAACTCGAGTTCTGGCACGTTCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012478.2-1713s1c1
Sequence:CCGGCCATGAAGTGAGGAGATGGTTCTCGAGAACCATCTCCTCACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-117s1c1
Sequence:CCGGCGTGGAACTCACATTCAATGACTCGAGTCATTGAATGTGAGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012478.2-952s1c1
Sequence:CCGGGAACTAGCATTGTGGGACATTCTCGAGAATGTCCCACAATGCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012478
WBP2 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012478.3-153s21c1
Sequence:CCGGCGGCGGAGTGATCGTCAATAACTCGAGTTATTGACGATCACTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012478.3-204s21c1
Sequence:CCGGCGTGGAACTCACATTCAATGACTCGAGTCATTGAATGTGAGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012478.3-1039s21c1
Sequence:CCGGGAACTAGCATTGTGGGACATTCTCGAGAATGTCCCACAATGCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012478.3-1800s21c1
Sequence:CCGGCCATGAAGTGAGGAGATGGTTCTCGAGAACCATCTCCTCACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-264s1c1
Sequence:CCGGCATGAAAGACTGTGAGATCAACTCGAGTTGATCTCACAGTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-237s1c1
Sequence:CCGGGCAGTCCTTCATGATGCCATTCTCGAGAATGGCATCATGAAGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012478.2-136s1c1
Sequence:CCGGGACATGAAGAACGTGCCAGAACTCGAGTTCTGGCACGTTCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012478.2-1713s1c1
Sequence:CCGGCCATGAAGTGAGGAGATGGTTCTCGAGAACCATCTCCTCACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-117s1c1
Sequence:CCGGCGTGGAACTCACATTCAATGACTCGAGTCATTGAATGTGAGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012478.2-952s1c1
Sequence:CCGGGAACTAGCATTGTGGGACATTCTCGAGAATGTCCCACAATGCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012478
WBP2 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012478.3-153s21c1
Sequence:CCGGCGGCGGAGTGATCGTCAATAACTCGAGTTATTGACGATCACTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012478.3-204s21c1
Sequence:CCGGCGTGGAACTCACATTCAATGACTCGAGTCATTGAATGTGAGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012478.3-1039s21c1
Sequence:CCGGGAACTAGCATTGTGGGACATTCTCGAGAATGTCCCACAATGCTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012478.3-1800s21c1
Sequence:CCGGCCATGAAGTGAGGAGATGGTTCTCGAGAACCATCTCCTCACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-264s1c1
Sequence:CCGGCATGAAAGACTGTGAGATCAACTCGAGTTGATCTCACAGTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-237s1c1
Sequence:CCGGGCAGTCCTTCATGATGCCATTCTCGAGAATGGCATCATGAAGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012478.2-136s1c1
Sequence:CCGGGACATGAAGAACGTGCCAGAACTCGAGTTCTGGCACGTTCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012478.2-1713s1c1
Sequence:CCGGCCATGAAGTGAGGAGATGGTTCTCGAGAACCATCTCCTCACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012478.2-117s1c1
Sequence:CCGGCGTGGAACTCACATTCAATGACTCGAGTCATTGAATGTGAGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012478.2-952s1c1
Sequence:CCGGGAACTAGCATTGTGGGACATTCTCGAGAATGTCCCACAATGCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016852
WBP2 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.2-126s1c1
Sequence:CCGGGCTTACCTTCAACGACATGAACTCGAGTTCATGTCGTTGAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.2-87s1c1
Sequence:CCGGCAACACTGAGAGCATCCTAATCTCGAGATTAGGATGCTCTCAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-149s21c1
Sequence:CCGGATGTGCCAGAGGCCTTCAAAGCTCGAGCTTTGAAGGCCTCTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-304s21c1
Sequence:CCGGGCGAACTTCATTAAGGGAATACTCGAGTATTCCCTTAATGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-205s21c1
Sequence:CCGGCGGGTCATCTTTCTGTCTAAGCTCGAGCTTAGACAGAAAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016852.2-1436s21c1
Sequence:CCGGCTACTGTTTCTGGGAATTATTCTCGAGAATAATTCCCAGAAACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.1-280s1c1
Sequence:CCGGGAGATTAAGCAGCCGGTGTTTCTCGAGAAACACCGGCTGCTTAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016852.1-1614s1c1
Sequence:CCGGGCACTAAGAATTGCTCTTGTTCTCGAGAACAAGAGCAATTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016852
WBP2 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.2-126s1c1
Sequence:CCGGGCTTACCTTCAACGACATGAACTCGAGTTCATGTCGTTGAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.2-87s1c1
Sequence:CCGGCAACACTGAGAGCATCCTAATCTCGAGATTAGGATGCTCTCAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-149s21c1
Sequence:CCGGATGTGCCAGAGGCCTTCAAAGCTCGAGCTTTGAAGGCCTCTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-304s21c1
Sequence:CCGGGCGAACTTCATTAAGGGAATACTCGAGTATTCCCTTAATGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-205s21c1
Sequence:CCGGCGGGTCATCTTTCTGTCTAAGCTCGAGCTTAGACAGAAAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016852.2-1436s21c1
Sequence:CCGGCTACTGTTTCTGGGAATTATTCTCGAGAATAATTCCCAGAAACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.1-280s1c1
Sequence:CCGGGAGATTAAGCAGCCGGTGTTTCTCGAGAAACACCGGCTGCTTAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016852.1-1614s1c1
Sequence:CCGGGCACTAAGAATTGCTCTTGTTCTCGAGAACAAGAGCAATTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016852
WBP2 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.2-126s1c1
Sequence:CCGGGCTTACCTTCAACGACATGAACTCGAGTTCATGTCGTTGAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.2-87s1c1
Sequence:CCGGCAACACTGAGAGCATCCTAATCTCGAGATTAGGATGCTCTCAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-149s21c1
Sequence:CCGGATGTGCCAGAGGCCTTCAAAGCTCGAGCTTTGAAGGCCTCTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-304s21c1
Sequence:CCGGGCGAACTTCATTAAGGGAATACTCGAGTATTCCCTTAATGAAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016852.2-205s21c1
Sequence:CCGGCGGGTCATCTTTCTGTCTAAGCTCGAGCTTAGACAGAAAGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016852.2-1436s21c1
Sequence:CCGGCTACTGTTTCTGGGAATTATTCTCGAGAATAATTCCCAGAAACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016852.1-280s1c1
Sequence:CCGGGAGATTAAGCAGCCGGTGTTTCTCGAGAAACACCGGCTGCTTAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016852.1-1614s1c1
Sequence:CCGGGCACTAAGAATTGCTCTTGTTCTCGAGAACAAGAGCAATTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks