EMAIL THIS PAGE TO A FRIEND

WBP2NL

WBP2 N-terminal like

Synonyms: PAWP
UniProtKB ID: Q6ICG8, A3KFF7, A8MSG5, B3KXX4, Q8TBF0, Q8TBF3
Gene ID:
Human(164684) Summary: WBP2NL is a sperm-specific WW domain-binding protein that promotes meiotic resumption and pronuclear development during oocyte fertilization (Wu et al., 2007 [PubMed 17289678]
Mouse(74716) WBP2 N-terminal like
Rat(688642) WBP2 N-terminal like
cow(523070) WBP2 N-terminal like
sheep(101105151) WBP2 N-terminal like
domestic guinea pig(100719510) WBP2 N-terminal like
naked mole-rat(101718998) WBP2 N-terminal like
dog(100685691) WBP2 N-terminal like
domestic cat(101090629) WBP2 N-terminal like
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152613 Rosetta Predictions human pricing
XM_001067725 Rosetta Predictions rat pricing
NM_029066 Rosetta Predictions mouse pricing
XM_905693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180667 predicted 476
2 SASI_Hs01_00180668 predicted 477
3 SASI_Hs01_00180669 predicted 1038
4 SASI_Hs01_00180670 predicted 278
5 SASI_Hs01_00180672 predicted 391
6 SASI_Hs02_00366465 predicted 527
7 SASI_Hs01_00180673 predicted 1025
8 SASI_Hs01_00180674 predicted 472
9 SASI_Hs01_00180675 predicted 479
10 SASI_Hs01_00180676 predicted 452
11 SASI_Hs01_00180671 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321968 predicted 519
2 SASI_Rn02_00321969 predicted 677
3 SASI_Rn02_00321970 predicted 767
4 SASI_Rn02_00321971 predicted 848
5 SASI_Rn02_00321972 predicted 271
6 SASI_Rn02_00321973 predicted 1081
7 SASI_Rn02_00321974 predicted 909
8 SASI_Rn02_00321975 predicted 721
9 SASI_Rn02_00321976 predicted 911
10 SASI_Rn02_00321977 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334803 predicted 834
2 SASI_Mm02_00334804 predicted 910
3 SASI_Mm02_00334805 predicted 428
4 SASI_Mm02_00334806 predicted 440
5 SASI_Mm02_00334807 predicted 282
6 SASI_Mm02_00334808 predicted 519
7 SASI_Mm02_00334809 predicted 1079
8 SASI_Mm02_00334810 predicted 259
9 SASI_Mm02_00334811 predicted 679
10 SASI_Mm02_00334812 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253190 predicted 717
2 SASI_Mm01_00253191 predicted 719
3 SASI_Mm01_00253192 predicted 789
4 SASI_Mm01_00253193 predicted 613
5 SASI_Mm01_00253194 predicted 698
6 SASI_Mm01_00253195 predicted 807
7 SASI_Mm01_00253196 predicted 617
8 SASI_Mm01_00253197 predicted 707
9 SASI_Mm01_00253198 predicted 782
10 SASI_Mm01_00253199 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152613
WBP2NL MISSION shRNA Bacterial Glycerol Stock
WBP2 N-terminal like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-514s1c1
Sequence:CCGGGAATATGTGCACTCCACAGATCTCGAGATCTGTGGAGTGCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-472s1c1
Sequence:CCGGCTGGTTCAGCTCTATGGGAATCTCGAGATTCCCATAGAGCTGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-441s1c1
Sequence:CCGGCCCGAGGATTTCCACTTAGAACTCGAGTTCTAAGTGGAAATCCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-266s1c1
Sequence:CCGGCTGATGACGAACCTCACTGTTCTCGAGAACAGTGAGGTTCGTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152613.1-991s1c1
Sequence:CCGGCCAAGCAAAGAGGTACCCTAACTCGAGTTAGGGTACCTCTTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-134s1c1
Sequence:CCGGCAGCGATCAGAAGGCTCAAATCTCGAGATTTGAGCCTTCTGATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-379s1c1
Sequence:CCGGCTTCAGAAATGGAGGTGCCATCTCGAGATGGCACCTCCATTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-136s1c1
Sequence:CCGGGCGATCAGAAGGCTCAAATGTCTCGAGACATTTGAGCCTTCTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-79s1c1
Sequence:CCGGCCCTAACGGTGAAAGTCTCTTCTCGAGAAGAGACTTTCACCGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152613.1-1468s1c1
Sequence:CCGGGCCTTCTTTGAGGAGACCAAACTCGAGTTTGGTCTCCTCAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-188s1c1
Sequence:CCGGCTCACTTCATACCGGGTGATTCTCGAGAATCACCCGGTATGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152613.1-1277s1c1
Sequence:CCGGCCATCCTCATTCAAGAAACATCTCGAGATGTTTCTTGAATGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-530s1c1
Sequence:CCGGCAGATGCCTTGTTCAGTTATTCTCGAGAATAACTGAACAAGGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152613
WBP2NL MISSION shRNA shRNA Plasmid DNA
WBP2 N-terminal like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-514s1c1
Sequence:CCGGGAATATGTGCACTCCACAGATCTCGAGATCTGTGGAGTGCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-472s1c1
Sequence:CCGGCTGGTTCAGCTCTATGGGAATCTCGAGATTCCCATAGAGCTGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-441s1c1
Sequence:CCGGCCCGAGGATTTCCACTTAGAACTCGAGTTCTAAGTGGAAATCCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-266s1c1
Sequence:CCGGCTGATGACGAACCTCACTGTTCTCGAGAACAGTGAGGTTCGTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152613.1-991s1c1
Sequence:CCGGCCAAGCAAAGAGGTACCCTAACTCGAGTTAGGGTACCTCTTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-134s1c1
Sequence:CCGGCAGCGATCAGAAGGCTCAAATCTCGAGATTTGAGCCTTCTGATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-379s1c1
Sequence:CCGGCTTCAGAAATGGAGGTGCCATCTCGAGATGGCACCTCCATTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-136s1c1
Sequence:CCGGGCGATCAGAAGGCTCAAATGTCTCGAGACATTTGAGCCTTCTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-79s1c1
Sequence:CCGGCCCTAACGGTGAAAGTCTCTTCTCGAGAAGAGACTTTCACCGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152613.1-1468s1c1
Sequence:CCGGGCCTTCTTTGAGGAGACCAAACTCGAGTTTGGTCTCCTCAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-188s1c1
Sequence:CCGGCTCACTTCATACCGGGTGATTCTCGAGAATCACCCGGTATGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152613.1-1277s1c1
Sequence:CCGGCCATCCTCATTCAAGAAACATCTCGAGATGTTTCTTGAATGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-530s1c1
Sequence:CCGGCAGATGCCTTGTTCAGTTATTCTCGAGAATAACTGAACAAGGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152613
WBP2NL MISSION shRNA Lentiviral Transduction Particles
WBP2 N-terminal like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-514s1c1
Sequence:CCGGGAATATGTGCACTCCACAGATCTCGAGATCTGTGGAGTGCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-472s1c1
Sequence:CCGGCTGGTTCAGCTCTATGGGAATCTCGAGATTCCCATAGAGCTGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-441s1c1
Sequence:CCGGCCCGAGGATTTCCACTTAGAACTCGAGTTCTAAGTGGAAATCCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-266s1c1
Sequence:CCGGCTGATGACGAACCTCACTGTTCTCGAGAACAGTGAGGTTCGTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152613.1-991s1c1
Sequence:CCGGCCAAGCAAAGAGGTACCCTAACTCGAGTTAGGGTACCTCTTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-134s1c1
Sequence:CCGGCAGCGATCAGAAGGCTCAAATCTCGAGATTTGAGCCTTCTGATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-379s1c1
Sequence:CCGGCTTCAGAAATGGAGGTGCCATCTCGAGATGGCACCTCCATTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-136s1c1
Sequence:CCGGGCGATCAGAAGGCTCAAATGTCTCGAGACATTTGAGCCTTCTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-79s1c1
Sequence:CCGGCCCTAACGGTGAAAGTCTCTTCTCGAGAAGAGACTTTCACCGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152613.1-1468s1c1
Sequence:CCGGGCCTTCTTTGAGGAGACCAAACTCGAGTTTGGTCTCCTCAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152613.1-188s1c1
Sequence:CCGGCTCACTTCATACCGGGTGATTCTCGAGAATCACCCGGTATGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152613.1-1277s1c1
Sequence:CCGGCCATCCTCATTCAAGAAACATCTCGAGATGTTTCTTGAATGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152613.1-530s1c1
Sequence:CCGGCAGATGCCTTGTTCAGTTATTCTCGAGAATAACTGAACAAGGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029066
WBP2NL MISSION shRNA Bacterial Glycerol Stock
WBP2 N-terminal like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-242s21c1
Sequence:CCGGTACGATGCCATTTCATCTAATCTCGAGATTAGATGAAATGGCATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029066.1-1135s21c1
Sequence:CCGGCTAATGTTGAAGTCAAGATAACTCGAGTTATCTTGACTTCAACATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-468s21c1
Sequence:CCGGATGGGCCCTCTAGGAATTTATCTCGAGATAAATTCCTAGAGGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-292s21c1
Sequence:CCGGTTGGTGCAAACTACATTAAAGCTCGAGCTTTAATGTAGTTTGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-684s21c1
Sequence:CCGGGGATACGGAGCTGTGAGATATCTCGAGATATCTCACAGCTCCGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029066
WBP2NL MISSION shRNA shRNA Plasmid DNA
WBP2 N-terminal like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-242s21c1
Sequence:CCGGTACGATGCCATTTCATCTAATCTCGAGATTAGATGAAATGGCATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029066.1-1135s21c1
Sequence:CCGGCTAATGTTGAAGTCAAGATAACTCGAGTTATCTTGACTTCAACATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-468s21c1
Sequence:CCGGATGGGCCCTCTAGGAATTTATCTCGAGATAAATTCCTAGAGGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-292s21c1
Sequence:CCGGTTGGTGCAAACTACATTAAAGCTCGAGCTTTAATGTAGTTTGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-684s21c1
Sequence:CCGGGGATACGGAGCTGTGAGATATCTCGAGATATCTCACAGCTCCGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029066
WBP2NL MISSION shRNA Lentiviral Transduction Particles
WBP2 N-terminal like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-242s21c1
Sequence:CCGGTACGATGCCATTTCATCTAATCTCGAGATTAGATGAAATGGCATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029066.1-1135s21c1
Sequence:CCGGCTAATGTTGAAGTCAAGATAACTCGAGTTATCTTGACTTCAACATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-468s21c1
Sequence:CCGGATGGGCCCTCTAGGAATTTATCTCGAGATAAATTCCTAGAGGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-292s21c1
Sequence:CCGGTTGGTGCAAACTACATTAAAGCTCGAGCTTTAATGTAGTTTGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029066.1-684s21c1
Sequence:CCGGGGATACGGAGCTGTGAGATATCTCGAGATATCTCACAGCTCCGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks