EMAIL THIS PAGE TO A FRIEND

WBP4

WW domain binding protein 4

Synonyms: FBP21
UniProtKB ID: O75554, Q32P29
Gene ID:
Human(11193) Summary: This gene encodes WW domain-containing binding protein 4. The WW domain represents a small and compact globular structure that interacts with proline-rich ligands. This encoded protein is a general spliceosomal protein that may play a role in cross-intron bridging of U1 and U2 snRNPs in the spliceosomal complex A. [provided by RefSeq, Jul 2008]
Mouse(22380) WW domain binding protein 4
Rat(114765) WW domain binding protein 4
Zebrafish(553723) WW domain binding protein 4
domestic cat(101091075) WW domain binding protein 4
dog(476935) WW domain binding protein 4
chicken(418829) WW domain binding protein 4 (formin binding protein 21)
naked mole-rat(101702155) WW domain binding protein 4
domestic guinea pig(100729950) WW domain binding protein 4
cow(506275) WW domain binding protein 4 (formin binding protein 21)
sheep(101107108) WW domain binding protein 4
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007187 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039671 MISSION® esiRNA esiRNA human WBP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007187 Rosetta Predictions human pricing
NM_053766 Rosetta Predictions rat pricing
NM_018765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121537 predicted 1495
2 SASI_Hs01_00121539 predicted 1131
3 SASI_Hs01_00121540 predicted 1317
4 SASI_Hs01_00121541 predicted 1624
5 SASI_Hs01_00121543 predicted 1105
6 SASI_Hs01_00121544 predicted 1107
7 SASI_Hs01_00121545 predicted 1297
8 SASI_Hs02_00343153 predicted 1135
9 SASI_Hs02_00343154 predicted 1563
10 SASI_Hs02_00343155 predicted 1289
11 SASI_Hs01_00121538 predicted 1532
12 SASI_Hs01_00121542 predicted 1106
13 SASI_Hs01_00121546 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093042 predicted 343
2 SASI_Rn01_00093043 predicted 355
3 SASI_Rn01_00093044 predicted 314
4 SASI_Rn01_00093045 predicted 303
5 SASI_Rn01_00093046 predicted 345
6 SASI_Rn01_00093047 predicted 294
7 SASI_Rn01_00093048 predicted 350
8 SASI_Rn01_00093049 predicted 321
9 SASI_Rn01_00093050 predicted 357
10 SASI_Rn01_00093051 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043602 predicted 1552
2 SASI_Mm01_00043603 predicted 1780
3 SASI_Mm02_00324077 predicted 359
4 SASI_Mm01_00043604 predicted 1736
5 SASI_Mm01_00043605 predicted 1672
6 SASI_Mm01_00043606 predicted 1679
7 SASI_Mm01_00043607 predicted 1910
8 SASI_Mm01_00043608 predicted 1548
9 SASI_Mm01_00043609 predicted 1825
10 SASI_Mm01_00043610 predicted 1447
11 SASI_Mm01_00043601 predicted 1771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018765
VALIDATED
WBP4 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018765.3-1942s21c1
Sequence:CCGGTCGGCTTGTCTTACTCCATTTCTCGAGAAATGGAGTAAGACAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-742s21c1
Sequence:CCGGGACGGCCACTGCTACTATTATCTCGAGATAATAGTAGCAGTGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-1062s21c1
Sequence:CCGGAGAGACCAAGAAGCTAATCATCTCGAGATGATTAGCTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-1004s21c1
Sequence:CCGGCCTCCGATTCTCACAGTGATTCTCGAGAATCACTGTGAGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-615s21c1
Sequence:CCGGGCCAACTGTATCACCAGTCATCTCGAGATGACTGGTGATACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-856s1c1
Sequence:CCGGCCTCCGATTCTCACAGTGATTCTCGAGAATCACTGTGAGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-411s1c1
Sequence:CCGGGCGTACCAAGAGGATTCTGAACTCGAGTTCAGAATCCTCTTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018765.1-914s1c1
Sequence:CCGGAGAGACCAAGAAGCTAATCATCTCGAGATGATTAGCTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018765.1-467s1c1
Sequence:CCGGGCCAACTGTATCACCAGTCATCTCGAGATGACTGGTGATACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-506s1c1
Sequence:CCGGCCCTACGTCAAATCAACAGAACTCGAGTTCTGTTGATTTGACGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018765
VALIDATED
WBP4 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018765.3-1942s21c1
Sequence:CCGGTCGGCTTGTCTTACTCCATTTCTCGAGAAATGGAGTAAGACAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-742s21c1
Sequence:CCGGGACGGCCACTGCTACTATTATCTCGAGATAATAGTAGCAGTGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-1062s21c1
Sequence:CCGGAGAGACCAAGAAGCTAATCATCTCGAGATGATTAGCTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-1004s21c1
Sequence:CCGGCCTCCGATTCTCACAGTGATTCTCGAGAATCACTGTGAGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-615s21c1
Sequence:CCGGGCCAACTGTATCACCAGTCATCTCGAGATGACTGGTGATACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-856s1c1
Sequence:CCGGCCTCCGATTCTCACAGTGATTCTCGAGAATCACTGTGAGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-411s1c1
Sequence:CCGGGCGTACCAAGAGGATTCTGAACTCGAGTTCAGAATCCTCTTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018765.1-914s1c1
Sequence:CCGGAGAGACCAAGAAGCTAATCATCTCGAGATGATTAGCTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018765.1-467s1c1
Sequence:CCGGGCCAACTGTATCACCAGTCATCTCGAGATGACTGGTGATACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-506s1c1
Sequence:CCGGCCCTACGTCAAATCAACAGAACTCGAGTTCTGTTGATTTGACGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018765
VALIDATED
WBP4 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018765.3-1942s21c1
Sequence:CCGGTCGGCTTGTCTTACTCCATTTCTCGAGAAATGGAGTAAGACAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-742s21c1
Sequence:CCGGGACGGCCACTGCTACTATTATCTCGAGATAATAGTAGCAGTGGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-1062s21c1
Sequence:CCGGAGAGACCAAGAAGCTAATCATCTCGAGATGATTAGCTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-1004s21c1
Sequence:CCGGCCTCCGATTCTCACAGTGATTCTCGAGAATCACTGTGAGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018765.3-615s21c1
Sequence:CCGGGCCAACTGTATCACCAGTCATCTCGAGATGACTGGTGATACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-856s1c1
Sequence:CCGGCCTCCGATTCTCACAGTGATTCTCGAGAATCACTGTGAGAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-411s1c1
Sequence:CCGGGCGTACCAAGAGGATTCTGAACTCGAGTTCAGAATCCTCTTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018765.1-914s1c1
Sequence:CCGGAGAGACCAAGAAGCTAATCATCTCGAGATGATTAGCTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018765.1-467s1c1
Sequence:CCGGGCCAACTGTATCACCAGTCATCTCGAGATGACTGGTGATACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018765.1-506s1c1
Sequence:CCGGCCCTACGTCAAATCAACAGAACTCGAGTTCTGTTGATTTGACGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007187
VALIDATED
WBP4 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007187.3-1105s21c1
Sequence:CCGGGAGAACCCAAAGTGGTATTTACTCGAGTAAATACCACTTTGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007187.3-992s21c1
Sequence:CCGGATATGGAGAATGGCAAGAAATCTCGAGATTTCTTGCCATTCTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007187.3-1223s21c1
Sequence:CCGGGCAACGAGGTGATGATCAATACTCGAGTATTGATCATCACCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007187.3-514s21c1
Sequence:CCGGCTGAGGGTTACCATTACTATTCTCGAGAATAGTAATGGTAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007187.3-1723s21c1
Sequence:CCGGTGGCTTACCTTACTCAATTTACTCGAGTAAATTGAGTAAGGTAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-336s1c1
Sequence:CCGGGCATACCAAGAGGATTTGAAACTCGAGTTTCAAATCCTCTTGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-726s1c1
Sequence:CCGGCCTTCTAGTAAGGTCAATGAACTCGAGTTCATTGACCTTACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-760s1c1
Sequence:CCGGCCCTAGATGAATCCAAATCATCTCGAGATGATTTGGATTCATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007187
VALIDATED
WBP4 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007187.3-1105s21c1
Sequence:CCGGGAGAACCCAAAGTGGTATTTACTCGAGTAAATACCACTTTGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007187.3-992s21c1
Sequence:CCGGATATGGAGAATGGCAAGAAATCTCGAGATTTCTTGCCATTCTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007187.3-1223s21c1
Sequence:CCGGGCAACGAGGTGATGATCAATACTCGAGTATTGATCATCACCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007187.3-514s21c1
Sequence:CCGGCTGAGGGTTACCATTACTATTCTCGAGAATAGTAATGGTAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007187.3-1723s21c1
Sequence:CCGGTGGCTTACCTTACTCAATTTACTCGAGTAAATTGAGTAAGGTAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-336s1c1
Sequence:CCGGGCATACCAAGAGGATTTGAAACTCGAGTTTCAAATCCTCTTGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-726s1c1
Sequence:CCGGCCTTCTAGTAAGGTCAATGAACTCGAGTTCATTGACCTTACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-760s1c1
Sequence:CCGGCCCTAGATGAATCCAAATCATCTCGAGATGATTTGGATTCATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007187
VALIDATED
WBP4 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007187.3-1105s21c1
Sequence:CCGGGAGAACCCAAAGTGGTATTTACTCGAGTAAATACCACTTTGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007187.3-992s21c1
Sequence:CCGGATATGGAGAATGGCAAGAAATCTCGAGATTTCTTGCCATTCTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007187.3-1223s21c1
Sequence:CCGGGCAACGAGGTGATGATCAATACTCGAGTATTGATCATCACCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007187.3-514s21c1
Sequence:CCGGCTGAGGGTTACCATTACTATTCTCGAGAATAGTAATGGTAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007187.3-1723s21c1
Sequence:CCGGTGGCTTACCTTACTCAATTTACTCGAGTAAATTGAGTAAGGTAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-336s1c1
Sequence:CCGGGCATACCAAGAGGATTTGAAACTCGAGTTTCAAATCCTCTTGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-726s1c1
Sequence:CCGGCCTTCTAGTAAGGTCAATGAACTCGAGTTCATTGACCTTACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007187.3-760s1c1
Sequence:CCGGCCCTAGATGAATCCAAATCATCTCGAGATGATTTGGATTCATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks