EMAIL THIS PAGE TO A FRIEND

WBP5

WW domain binding protein 5

Synonyms: TCEAL9
UniProtKB ID: Q9UHQ7, B2R5H6
Gene ID:
Human(51186) Summary: The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein. This gene also encodes a domain with similarity to the transcription elongation factor A, SII-related family. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
Mouse(22381) WW domain binding protein 5
Rat(680354) WW domain binding protein 5
cow(532320) WW domain binding protein 5
sheep(101117908) WW domain binding protein 5
domestic guinea pig(100729916) WW domain binding protein 5
naked mole-rat(101702348) WW domain binding protein 5
domestic cat(101095557) WW domain binding protein 5
dog(100682551) WW domain binding protein 5
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011790 Anti-WBP5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106464 Anti-WBP5 antibody produced in rabbit affinity isolated antibody rabbit, human, horse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006612 Rosetta Predictions human pricing
NM_001006613 Rosetta Predictions human pricing
NM_001006614 Rosetta Predictions human pricing
NM_016303 Rosetta Predictions human pricing
NM_001127502 Rosetta Predictions rat pricing
NM_011712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017575 predicted 533
2 SASI_Hs01_00017576 predicted 861
3 SASI_Hs01_00017577 predicted 898
4 SASI_Hs01_00017578 predicted 551
5 SASI_Hs01_00017579 predicted 428
6 SASI_Hs01_00017580 predicted 477
7 SASI_Hs01_00017581 predicted 491
8 SASI_Hs01_00017582 predicted 440
9 SASI_Hs01_00017583 predicted 863
10 SASI_Hs02_00305085 predicted 931
11 SASI_Hs01_00017574 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085194 predicted 452
2 SASI_Hs01_00085195 predicted 781
3 SASI_Hs01_00085196 predicted 823
4 SASI_Hs01_00085197 predicted 471
5 SASI_Hs01_00085198 predicted 358
6 SASI_Hs01_00085199 predicted 399
7 SASI_Hs01_00085200 predicted 422
8 SASI_Hs01_00085201 predicted 365
9 SASI_Hs01_00085202 predicted 780
10 SASI_Hs02_00305086 predicted 849
11 SASI_Hs01_00085193 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237287 predicted 456
2 SASI_Hs01_00237288 predicted 776
3 SASI_Hs01_00237289 predicted 826
4 SASI_Hs01_00237290 predicted 466
5 SASI_Hs01_00237291 predicted 355
6 SASI_Hs01_00237292 predicted 402
7 SASI_Hs01_00237293 predicted 412
8 SASI_Hs01_00237294 predicted 368
9 SASI_Hs02_00305087 predicted 778
10 SASI_Hs01_00237295 predicted 845
11 SASI_Hs01_00237286 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096405 predicted 533
2 SASI_Hs01_00096406 predicted 857
3 SASI_Hs01_00096407 predicted 905
4 SASI_Hs01_00096408 predicted 549
5 SASI_Hs01_00096409 predicted 439
6 SASI_Hs01_00096410 predicted 476
7 SASI_Hs01_00096411 predicted 494
8 SASI_Hs01_00096412 predicted 450
9 SASI_Hs01_00096413 predicted 861
10 SASI_Hs02_00349229 predicted 930
11 SASI_Hs01_00096404 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253933 predicted 483
2 SASI_Rn02_00253934 predicted 444
3 SASI_Rn02_00253935 predicted 483
4 SASI_Rn02_00253936 predicted 452
5 SASI_Rn02_00253937 predicted 454
6 SASI_Rn02_00253938 predicted 403
7 SASI_Rn02_00253939 predicted 503
8 SASI_Rn02_00253940 predicted 451
9 SASI_Rn02_00253941 predicted 433
10 SASI_Rn02_00253942 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056595 predicted 350
2 SASI_Mm01_00056596 predicted 472
3 SASI_Mm01_00056597 predicted 372
4 SASI_Mm01_00056598 predicted 502
5 SASI_Mm01_00056599 predicted 505
6 SASI_Mm01_00056600 predicted 428
7 SASI_Mm01_00056601 predicted 390
8 SASI_Mm01_00056602 predicted 433
9 SASI_Mm01_00056603 predicted 433
10 SASI_Mm01_00056604 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016303
VALIDATED
WBP5 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016303.1-304s1c1
Sequence:CCGGGAGTGAACCAAAGCATGAGGACTCGAGTCCTCATGCTTTGGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.2-680s1c1
Sequence:CCGGCCTGATATTCCTTTGTCCATACTCGAGTATGGACAAAGGAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-406s1c1
Sequence:CCGGGCTGATTCAATCTCTCCAGGACTCGAGTCCTGGAGAGATTGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016303.1-443s1c1
Sequence:CCGGCACAACAGGCATTTAAGCAATCTCGAGATTGCTTAAATGCCTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016303.2-783s1c1
Sequence:CCGGCAATCTACAAGTCTCTGTCTTCTCGAGAAGACAGAGACTTGTAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-434s1c1
Sequence:CCGGGAAGATATACACAACAGGCATCTCGAGATGCCTGTTGTGTATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-494s1c1
Sequence:CCGGGATGAGATAAGGAGAGTCAGACTCGAGTCTGACTCTCCTTATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016303.2-743s1c1
Sequence:CCGGCTCTTGTTATCTGCATCTCATCTCGAGATGAGATGCAGATAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016303.1-542s1c1
Sequence:CCGGGTTAATCGAAACCATCCTTACCTCGAGGTAAGGATGGTTTCGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016303
VALIDATED
WBP5 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016303.1-304s1c1
Sequence:CCGGGAGTGAACCAAAGCATGAGGACTCGAGTCCTCATGCTTTGGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.2-680s1c1
Sequence:CCGGCCTGATATTCCTTTGTCCATACTCGAGTATGGACAAAGGAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-406s1c1
Sequence:CCGGGCTGATTCAATCTCTCCAGGACTCGAGTCCTGGAGAGATTGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016303.1-443s1c1
Sequence:CCGGCACAACAGGCATTTAAGCAATCTCGAGATTGCTTAAATGCCTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016303.2-783s1c1
Sequence:CCGGCAATCTACAAGTCTCTGTCTTCTCGAGAAGACAGAGACTTGTAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-434s1c1
Sequence:CCGGGAAGATATACACAACAGGCATCTCGAGATGCCTGTTGTGTATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-494s1c1
Sequence:CCGGGATGAGATAAGGAGAGTCAGACTCGAGTCTGACTCTCCTTATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016303.2-743s1c1
Sequence:CCGGCTCTTGTTATCTGCATCTCATCTCGAGATGAGATGCAGATAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016303.1-542s1c1
Sequence:CCGGGTTAATCGAAACCATCCTTACCTCGAGGTAAGGATGGTTTCGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016303
VALIDATED
WBP5 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016303.1-304s1c1
Sequence:CCGGGAGTGAACCAAAGCATGAGGACTCGAGTCCTCATGCTTTGGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.2-680s1c1
Sequence:CCGGCCTGATATTCCTTTGTCCATACTCGAGTATGGACAAAGGAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-406s1c1
Sequence:CCGGGCTGATTCAATCTCTCCAGGACTCGAGTCCTGGAGAGATTGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016303.1-443s1c1
Sequence:CCGGCACAACAGGCATTTAAGCAATCTCGAGATTGCTTAAATGCCTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016303.2-783s1c1
Sequence:CCGGCAATCTACAAGTCTCTGTCTTCTCGAGAAGACAGAGACTTGTAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-434s1c1
Sequence:CCGGGAAGATATACACAACAGGCATCTCGAGATGCCTGTTGTGTATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016303.1-494s1c1
Sequence:CCGGGATGAGATAAGGAGAGTCAGACTCGAGTCTGACTCTCCTTATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016303.2-743s1c1
Sequence:CCGGCTCTTGTTATCTGCATCTCATCTCGAGATGAGATGCAGATAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016303.1-542s1c1
Sequence:CCGGGTTAATCGAAACCATCCTTACCTCGAGGTAAGGATGGTTTCGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011712
VALIDATED
WBP5 MISSION shRNA Bacterial Glycerol Stock
WW domain binding protein 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-595s1c1
Sequence:CCGGGCCCATCTTCCTACTTTGAATCTCGAGATTCAAAGTAGGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011712.1-452s1c1
Sequence:CCGGACAAACTTATAGTGACGCGTTCTCGAGAACGCGTCACTATAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-424s1c1
Sequence:CCGGGAGCTAGATGAGATCAGGAAACTCGAGTTTCCTGATCTCATCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011712.1-308s1c1
Sequence:CCGGAGGAGGAGAAATCCGAAGAAACTCGAGTTTCTTCGGATTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-435s1c1
Sequence:CCGGGATCAGGAAAGTGAGAAACAACTCGAGTTGTTTCTCACTTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-470s21c1
Sequence:CCGGGAGCTAGATGAGATCAGGAAACTCGAGTTTCCTGATCTCATCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-481s21c1
Sequence:CCGGGATCAGGAAAGTGAGAAACAACTCGAGTTGTTTCTCACTTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-391s21c1
Sequence:CCGGGATCCGGTCTCTGCAGGATTTCTCGAGAAATCCTGCAGAGACCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-438s21c1
Sequence:CCGGTGAGCAGTGATGATCTGTTTACTCGAGTAAACAGATCATCACTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-641s21c1
Sequence:CCGGGCCCATCTTCCTACTTTGAATCTCGAGATTCAAAGTAGGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011712
VALIDATED
WBP5 MISSION shRNA shRNA Plasmid DNA
WW domain binding protein 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-595s1c1
Sequence:CCGGGCCCATCTTCCTACTTTGAATCTCGAGATTCAAAGTAGGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011712.1-452s1c1
Sequence:CCGGACAAACTTATAGTGACGCGTTCTCGAGAACGCGTCACTATAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-424s1c1
Sequence:CCGGGAGCTAGATGAGATCAGGAAACTCGAGTTTCCTGATCTCATCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011712.1-308s1c1
Sequence:CCGGAGGAGGAGAAATCCGAAGAAACTCGAGTTTCTTCGGATTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-435s1c1
Sequence:CCGGGATCAGGAAAGTGAGAAACAACTCGAGTTGTTTCTCACTTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-470s21c1
Sequence:CCGGGAGCTAGATGAGATCAGGAAACTCGAGTTTCCTGATCTCATCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-481s21c1
Sequence:CCGGGATCAGGAAAGTGAGAAACAACTCGAGTTGTTTCTCACTTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-391s21c1
Sequence:CCGGGATCCGGTCTCTGCAGGATTTCTCGAGAAATCCTGCAGAGACCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-438s21c1
Sequence:CCGGTGAGCAGTGATGATCTGTTTACTCGAGTAAACAGATCATCACTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-641s21c1
Sequence:CCGGGCCCATCTTCCTACTTTGAATCTCGAGATTCAAAGTAGGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011712
VALIDATED
WBP5 MISSION shRNA Lentiviral Transduction Particles
WW domain binding protein 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-595s1c1
Sequence:CCGGGCCCATCTTCCTACTTTGAATCTCGAGATTCAAAGTAGGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011712.1-452s1c1
Sequence:CCGGACAAACTTATAGTGACGCGTTCTCGAGAACGCGTCACTATAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-424s1c1
Sequence:CCGGGAGCTAGATGAGATCAGGAAACTCGAGTTTCCTGATCTCATCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011712.1-308s1c1
Sequence:CCGGAGGAGGAGAAATCCGAAGAAACTCGAGTTTCTTCGGATTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011712.1-435s1c1
Sequence:CCGGGATCAGGAAAGTGAGAAACAACTCGAGTTGTTTCTCACTTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-470s21c1
Sequence:CCGGGAGCTAGATGAGATCAGGAAACTCGAGTTTCCTGATCTCATCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-481s21c1
Sequence:CCGGGATCAGGAAAGTGAGAAACAACTCGAGTTGTTTCTCACTTTCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-391s21c1
Sequence:CCGGGATCCGGTCTCTGCAGGATTTCTCGAGAAATCCTGCAGAGACCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-438s21c1
Sequence:CCGGTGAGCAGTGATGATCTGTTTACTCGAGTAAACAGATCATCACTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011712.2-641s21c1
Sequence:CCGGGCCCATCTTCCTACTTTGAATCTCGAGATTCAAAGTAGGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks