EMAIL THIS PAGE TO A FRIEND

WBSCR16

Williams-Beuren syndrome chromosome region 16

UniProtKB ID: Q96I51, D3DXK0, Q548B1, Q9H0G7
Gene ID:
Human(81554) Summary: This gene encodes an RCC1-like G-exchanging factor. It is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Jul 2008]
Mouse(94254) Williams-Beuren syndrome chromosome region 16 homolog (human)
Rat(360796) Williams-Beuren syndrome chromosome region 16
Zebrafish(555972) Williams-Beuren syndrome chromosome region 16 homolog (human)
chicken(417484) Williams-Beuren syndrome chromosome region 16
naked mole-rat(101720236) Williams-Beuren syndrome chromosome region 16
cow(513273) Williams-Beuren syndrome chromosomal region 16 protein
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030798 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030798 Rosetta Predictions human pricing
NM_001108332 Rosetta Predictions rat pricing
NM_033572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204261 predicted 853
2 SASI_Hs01_00204262 predicted 845
3 SASI_Hs01_00204263 predicted 1264
4 SASI_Hs01_00204264 predicted 1769
5 SASI_Hs01_00204265 predicted 725
6 SASI_Hs01_00204266 predicted 772
7 SASI_Hs01_00204267 predicted 718
8 SASI_Hs01_00204268 predicted 965
9 SASI_Hs01_00204269 predicted 999
10 SASI_Hs02_00358358 predicted 857
11 SASI_Hs01_00204270 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237619 predicted 1083
2 SASI_Rn02_00237620 predicted 1150
3 SASI_Rn02_00237621 predicted 1189
4 SASI_Rn02_00237622 predicted 1096
5 SASI_Rn02_00237623 predicted 1506
6 SASI_Rn02_00237624 predicted 693
7 SASI_Rn02_00237625 predicted 454
8 SASI_Rn02_00237626 predicted 1271
9 SASI_Rn02_00237627 predicted 1208
10 SASI_Rn02_00237628 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083115 predicted 1803
2 SASI_Mm01_00083116 predicted 1579
3 SASI_Mm01_00083117 predicted 777
4 SASI_Mm01_00083118 predicted 1160
5 SASI_Mm01_00083119 predicted 696
6 SASI_Mm01_00083120 predicted 1768
7 SASI_Mm01_00083121 predicted 630
8 SASI_Mm01_00083122 predicted 447
9 SASI_Mm01_00083123 predicted 677
10 SASI_Mm02_00337406 predicted 1264
11 SASI_Mm01_00083124 predicted 1764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033572
VALIDATED
WBSCR16 MISSION shRNA Bacterial Glycerol Stock
Williams-Beuren syndrome chromosome region 16
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-1196s21c1
Sequence:CCGGCTTTGGTTTGACGGAGTTTAACTCGAGTTAAACTCCGTCAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-383s21c1
Sequence:CCGGCTGTGGCTATGGATTCACATTCTCGAGAATGTGAATCCATAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-781s21c1
Sequence:CCGGCAGACAAAGGTGAAGTCTATTCTCGAGAATAGACTTCACCTTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-927s21c1
Sequence:CCGGTGCTTAGCTTTGTCCGCTGATCTCGAGATCAGCGGACAAAGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-780s1c1
Sequence:CCGGCAGACAAAGGTGAAGTCTATTCTCGAGAATAGACTTCACCTTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-926s1c1
Sequence:CCGGTGCTTAGCTTTGTCCGCTGATCTCGAGATCAGCGGACAAAGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-382s1c1
Sequence:CCGGCTGTGGCTATGGATTCACATTCTCGAGAATGTGAATCCATAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-1195s1c1
Sequence:CCGGCTTTGGTTTGACGGAGTTTAACTCGAGTTAAACTCCGTCAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-1400s1c1
Sequence:CCGGGTGGATCACATGGTGACTCTACTCGAGTAGAGTCACCATGTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033572
VALIDATED
WBSCR16 MISSION shRNA shRNA Plasmid DNA
Williams-Beuren syndrome chromosome region 16
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-1196s21c1
Sequence:CCGGCTTTGGTTTGACGGAGTTTAACTCGAGTTAAACTCCGTCAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-383s21c1
Sequence:CCGGCTGTGGCTATGGATTCACATTCTCGAGAATGTGAATCCATAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-781s21c1
Sequence:CCGGCAGACAAAGGTGAAGTCTATTCTCGAGAATAGACTTCACCTTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-927s21c1
Sequence:CCGGTGCTTAGCTTTGTCCGCTGATCTCGAGATCAGCGGACAAAGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-780s1c1
Sequence:CCGGCAGACAAAGGTGAAGTCTATTCTCGAGAATAGACTTCACCTTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-926s1c1
Sequence:CCGGTGCTTAGCTTTGTCCGCTGATCTCGAGATCAGCGGACAAAGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-382s1c1
Sequence:CCGGCTGTGGCTATGGATTCACATTCTCGAGAATGTGAATCCATAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-1195s1c1
Sequence:CCGGCTTTGGTTTGACGGAGTTTAACTCGAGTTAAACTCCGTCAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-1400s1c1
Sequence:CCGGGTGGATCACATGGTGACTCTACTCGAGTAGAGTCACCATGTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033572
VALIDATED
WBSCR16 MISSION shRNA Lentiviral Transduction Particles
Williams-Beuren syndrome chromosome region 16
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-1196s21c1
Sequence:CCGGCTTTGGTTTGACGGAGTTTAACTCGAGTTAAACTCCGTCAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-383s21c1
Sequence:CCGGCTGTGGCTATGGATTCACATTCTCGAGAATGTGAATCCATAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-781s21c1
Sequence:CCGGCAGACAAAGGTGAAGTCTATTCTCGAGAATAGACTTCACCTTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033572.2-927s21c1
Sequence:CCGGTGCTTAGCTTTGTCCGCTGATCTCGAGATCAGCGGACAAAGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-780s1c1
Sequence:CCGGCAGACAAAGGTGAAGTCTATTCTCGAGAATAGACTTCACCTTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-926s1c1
Sequence:CCGGTGCTTAGCTTTGTCCGCTGATCTCGAGATCAGCGGACAAAGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-382s1c1
Sequence:CCGGCTGTGGCTATGGATTCACATTCTCGAGAATGTGAATCCATAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-1195s1c1
Sequence:CCGGCTTTGGTTTGACGGAGTTTAACTCGAGTTAAACTCCGTCAAACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033572.1-1400s1c1
Sequence:CCGGGTGGATCACATGGTGACTCTACTCGAGTAGAGTCACCATGTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030798
VALIDATED
WBSCR16 MISSION shRNA Bacterial Glycerol Stock
Williams-Beuren syndrome chromosome region 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-491s21c1
Sequence:CCGGCCTCTAAGACTGCGGATGTTACTCGAGTAACATCCGCAGTCTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-1324s21c1
Sequence:CCGGCGATGTGGACTCAGCCACTTTCTCGAGAAAGTGGCTGAGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-676s21c1
Sequence:CCGGGCTCACTCTCTTGTGTTGACTCTCGAGAGTCAACACAAGAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030798.3-863s21c1
Sequence:CCGGCGGATAAAGGAGAAGTCTATTCTCGAGAATAGACTTCTCCTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-705s21c1
Sequence:CCGGAGGAGTCTTCAGCATGGGAAACTCGAGTTTCCCATGCTGAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-643s1c1
Sequence:CCGGAGGAGTCTTCAGCATGGGAAACTCGAGTTTCCCATGCTGAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-614s1c1
Sequence:CCGGGCTCACTCTCTTGTGTTGACTCTCGAGAGTCAACACAAGAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-429s1c1
Sequence:CCGGCCTCTAAGACTGCGGATGTTACTCGAGTAACATCCGCAGTCTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-1262s1c1
Sequence:CCGGCGATGTGGACTCAGCCACTTTCTCGAGAAAGTGGCTGAGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-801s1c1
Sequence:CCGGCGGATAAAGGAGAAGTCTATTCTCGAGAATAGACTTCTCCTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030798
VALIDATED
WBSCR16 MISSION shRNA shRNA Plasmid DNA
Williams-Beuren syndrome chromosome region 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-491s21c1
Sequence:CCGGCCTCTAAGACTGCGGATGTTACTCGAGTAACATCCGCAGTCTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-1324s21c1
Sequence:CCGGCGATGTGGACTCAGCCACTTTCTCGAGAAAGTGGCTGAGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-676s21c1
Sequence:CCGGGCTCACTCTCTTGTGTTGACTCTCGAGAGTCAACACAAGAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030798.3-863s21c1
Sequence:CCGGCGGATAAAGGAGAAGTCTATTCTCGAGAATAGACTTCTCCTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-705s21c1
Sequence:CCGGAGGAGTCTTCAGCATGGGAAACTCGAGTTTCCCATGCTGAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-643s1c1
Sequence:CCGGAGGAGTCTTCAGCATGGGAAACTCGAGTTTCCCATGCTGAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-614s1c1
Sequence:CCGGGCTCACTCTCTTGTGTTGACTCTCGAGAGTCAACACAAGAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-429s1c1
Sequence:CCGGCCTCTAAGACTGCGGATGTTACTCGAGTAACATCCGCAGTCTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-1262s1c1
Sequence:CCGGCGATGTGGACTCAGCCACTTTCTCGAGAAAGTGGCTGAGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-801s1c1
Sequence:CCGGCGGATAAAGGAGAAGTCTATTCTCGAGAATAGACTTCTCCTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030798
VALIDATED
WBSCR16 MISSION shRNA Lentiviral Transduction Particles
Williams-Beuren syndrome chromosome region 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-491s21c1
Sequence:CCGGCCTCTAAGACTGCGGATGTTACTCGAGTAACATCCGCAGTCTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-1324s21c1
Sequence:CCGGCGATGTGGACTCAGCCACTTTCTCGAGAAAGTGGCTGAGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-676s21c1
Sequence:CCGGGCTCACTCTCTTGTGTTGACTCTCGAGAGTCAACACAAGAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030798.3-863s21c1
Sequence:CCGGCGGATAAAGGAGAAGTCTATTCTCGAGAATAGACTTCTCCTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030798.3-705s21c1
Sequence:CCGGAGGAGTCTTCAGCATGGGAAACTCGAGTTTCCCATGCTGAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-643s1c1
Sequence:CCGGAGGAGTCTTCAGCATGGGAAACTCGAGTTTCCCATGCTGAAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-614s1c1
Sequence:CCGGGCTCACTCTCTTGTGTTGACTCTCGAGAGTCAACACAAGAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-429s1c1
Sequence:CCGGCCTCTAAGACTGCGGATGTTACTCGAGTAACATCCGCAGTCTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-1262s1c1
Sequence:CCGGCGATGTGGACTCAGCCACTTTCTCGAGAAAGTGGCTGAGTCCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_030798.2-801s1c1
Sequence:CCGGCGGATAAAGGAGAAGTCTATTCTCGAGAATAGACTTCTCCTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks