EMAIL THIS PAGE TO A FRIEND

WBSCR17

Williams-Beuren syndrome chromosome region 17

Synonyms: GALNACT17 GALNT16 GALNT20 GALNTL3
UniProtKB ID: Q6IS24, Q8NFV9, Q9NTA8
Gene ID:
Human(64409) Summary: This gene encodes an N-acetylgalactosaminyltransferase. This gene is located centromeric to the common deleted region in Williams-Beuren syndrome (WBS), a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. This protein may play a role in membrane trafficking. [provided by RefSeq, Jan 2013]
Mouse(212996) Williams-Beuren syndrome chromosome region 17 homolog (human)
Rat(288611) Williams-Beuren syndrome chromosome region 17
cow(505622) Williams-Beuren syndrome chromosome region 17
sheep(101109586) Williams-Beuren syndrome chromosome region 17
domestic guinea pig(100734791) Williams-Beuren syndrome chromosome region 17
naked mole-rat(101716902) Williams-Beuren syndrome chromosome region 17
chicken(417480) Williams-Beuren syndrome chromosome region 17
domestic cat(101083227) Williams-Beuren syndrome chromosome region 17
dog(489790) Williams-Beuren syndrome chromosome region 17
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022479 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022479 Rosetta Predictions human pricing
NM_001025112 Rosetta Predictions rat pricing
NM_145218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073321 predicted 334
2 SASI_Hs01_00073322 predicted 1772
3 SASI_Hs01_00073323 predicted 1142
4 SASI_Hs01_00073324 predicted 826
5 SASI_Hs01_00073325 predicted 395
6 SASI_Hs01_00073326 predicted 241
7 SASI_Hs01_00073327 predicted 1323
8 SASI_Hs01_00073328 predicted 461
9 SASI_Hs01_00073329 predicted 1268
10 SASI_Hs01_00073330 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106177 predicted 334
2 SASI_Rn01_00106179 predicted 399
3 SASI_Rn01_00106181 predicted 1040
4 SASI_Rn01_00106182 predicted 1359
5 SASI_Rn01_00106183 predicted 416
6 SASI_Rn01_00106184 predicted 220
7 SASI_Rn01_00106185 predicted 1241
8 SASI_Rn01_00106186 predicted 355
9 SASI_Rn02_00203002 predicted 1319
10 SASI_Rn02_00203003 predicted 1257
11 SASI_Rn01_00106178 predicted 1353
12 SASI_Rn01_00106180 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184069 predicted 2199
2 SASI_Mm02_00340592 predicted 2662
3 SASI_Mm01_00184070 predicted 2272
4 SASI_Mm01_00184071 predicted 2256
5 SASI_Mm02_00340593 predicted 2680
6 SASI_Mm01_00184072 predicted 1335
7 SASI_Mm01_00184073 predicted 2063
8 SASI_Mm02_00340594 predicted 2566
9 SASI_Mm01_00184074 predicted 2171
10 SASI_Mm01_00184075 predicted 1276
11 SASI_Mm01_00184076 predicted 332
12 SASI_Mm01_00184077 predicted 727
13 SASI_Mm01_00184078 predicted 1961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022479
WBSCR17 MISSION shRNA Bacterial Glycerol Stock
Williams-Beuren syndrome chromosome region 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2283s1c1
Sequence:CCGGCGAGGTTACTTCTACCCAGATCTCGAGATCTGGGTAGAAGTAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1348s1c1
Sequence:CCGGCTGGACCATGTTTACCCAGAACTCGAGTTCTGGGTAAACATGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022479.1-1140s1c1
Sequence:CCGGGCGGAAGAAGAAGCCATATAACTCGAGTTATATGGCTTCTTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1291s1c1
Sequence:CCGGGTCTCCGAAAGAAGAGCATTACTCGAGTAATGCTCTTCTTTCGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2419s1c1
Sequence:CCGGGCTGATGCTTTCTCTCCTAATCTCGAGATTAGGAGAGAAAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022479.1-1465s1c1
Sequence:CCGGGCAATATTGTATCCGTGCCATCTCGAGATGGCACGGATACAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-999s1c1
Sequence:CCGGCAGGAAGTTCTTCGGTGAAATCTCGAGATTTCACCGAAGAACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-342s1c1
Sequence:CCGGCCATGAGAAGTATGGCTACAACTCGAGTTGTAGCCATACTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2503s1c1
Sequence:CCGGCCAGAGACAGAAATAGGCTAACTCGAGTTAGCCTATTTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1404s1c1
Sequence:CCGGGCTTCGCAACAACAAGGCAAACTCGAGTTTGCCTTGTTGTTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022479
WBSCR17 MISSION shRNA shRNA Plasmid DNA
Williams-Beuren syndrome chromosome region 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2283s1c1
Sequence:CCGGCGAGGTTACTTCTACCCAGATCTCGAGATCTGGGTAGAAGTAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1348s1c1
Sequence:CCGGCTGGACCATGTTTACCCAGAACTCGAGTTCTGGGTAAACATGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022479.1-1140s1c1
Sequence:CCGGGCGGAAGAAGAAGCCATATAACTCGAGTTATATGGCTTCTTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1291s1c1
Sequence:CCGGGTCTCCGAAAGAAGAGCATTACTCGAGTAATGCTCTTCTTTCGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2419s1c1
Sequence:CCGGGCTGATGCTTTCTCTCCTAATCTCGAGATTAGGAGAGAAAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022479.1-1465s1c1
Sequence:CCGGGCAATATTGTATCCGTGCCATCTCGAGATGGCACGGATACAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-999s1c1
Sequence:CCGGCAGGAAGTTCTTCGGTGAAATCTCGAGATTTCACCGAAGAACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-342s1c1
Sequence:CCGGCCATGAGAAGTATGGCTACAACTCGAGTTGTAGCCATACTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2503s1c1
Sequence:CCGGCCAGAGACAGAAATAGGCTAACTCGAGTTAGCCTATTTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1404s1c1
Sequence:CCGGGCTTCGCAACAACAAGGCAAACTCGAGTTTGCCTTGTTGTTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022479
WBSCR17 MISSION shRNA Lentiviral Transduction Particles
Williams-Beuren syndrome chromosome region 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2283s1c1
Sequence:CCGGCGAGGTTACTTCTACCCAGATCTCGAGATCTGGGTAGAAGTAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1348s1c1
Sequence:CCGGCTGGACCATGTTTACCCAGAACTCGAGTTCTGGGTAAACATGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022479.1-1140s1c1
Sequence:CCGGGCGGAAGAAGAAGCCATATAACTCGAGTTATATGGCTTCTTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1291s1c1
Sequence:CCGGGTCTCCGAAAGAAGAGCATTACTCGAGTAATGCTCTTCTTTCGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2419s1c1
Sequence:CCGGGCTGATGCTTTCTCTCCTAATCTCGAGATTAGGAGAGAAAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022479.1-1465s1c1
Sequence:CCGGGCAATATTGTATCCGTGCCATCTCGAGATGGCACGGATACAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-999s1c1
Sequence:CCGGCAGGAAGTTCTTCGGTGAAATCTCGAGATTTCACCGAAGAACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-342s1c1
Sequence:CCGGCCATGAGAAGTATGGCTACAACTCGAGTTGTAGCCATACTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022479.1-2503s1c1
Sequence:CCGGCCAGAGACAGAAATAGGCTAACTCGAGTTAGCCTATTTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022479.1-1404s1c1
Sequence:CCGGGCTTCGCAACAACAAGGCAAACTCGAGTTTGCCTTGTTGTTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145218
WBSCR17 MISSION shRNA Bacterial Glycerol Stock
Williams-Beuren syndrome chromosome region 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145218.2-3005s1c1
Sequence:CCGGCGCTTACTGCTCAGCTCATTTCTCGAGAAATGAGCTGAGCAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-546s1c1
Sequence:CCGGGCAGCTTAATGGCTTATCTAACTCGAGTTAGATAAGCCATTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1722s1c1
Sequence:CCGGGCTTCGTAATAATAAGGCCAACTCGAGTTGGCCTTATTATTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1969s1c1
Sequence:CCGGCGTTGGAACTTCATCCAGAATCTCGAGATTCTGGATGAAGTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1458s1c1
Sequence:CCGGGCGGAAGAAGAAACCGTATAACTCGAGTTATACGGTTTCTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145218
WBSCR17 MISSION shRNA shRNA Plasmid DNA
Williams-Beuren syndrome chromosome region 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145218.2-3005s1c1
Sequence:CCGGCGCTTACTGCTCAGCTCATTTCTCGAGAAATGAGCTGAGCAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-546s1c1
Sequence:CCGGGCAGCTTAATGGCTTATCTAACTCGAGTTAGATAAGCCATTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1722s1c1
Sequence:CCGGGCTTCGTAATAATAAGGCCAACTCGAGTTGGCCTTATTATTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1969s1c1
Sequence:CCGGCGTTGGAACTTCATCCAGAATCTCGAGATTCTGGATGAAGTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1458s1c1
Sequence:CCGGGCGGAAGAAGAAACCGTATAACTCGAGTTATACGGTTTCTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145218
WBSCR17 MISSION shRNA Lentiviral Transduction Particles
Williams-Beuren syndrome chromosome region 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145218.2-3005s1c1
Sequence:CCGGCGCTTACTGCTCAGCTCATTTCTCGAGAAATGAGCTGAGCAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-546s1c1
Sequence:CCGGGCAGCTTAATGGCTTATCTAACTCGAGTTAGATAAGCCATTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1722s1c1
Sequence:CCGGGCTTCGTAATAATAAGGCCAACTCGAGTTGGCCTTATTATTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1969s1c1
Sequence:CCGGCGTTGGAACTTCATCCAGAATCTCGAGATTCTGGATGAAGTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145218.2-1458s1c1
Sequence:CCGGGCGGAAGAAGAAACCGTATAACTCGAGTTATACGGTTTCTTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks