EMAIL THIS PAGE TO A FRIEND

WBSCR22

Williams Beuren syndrome chromosome region 22

Synonyms: HASJ4442 HUSSY-3 MERM1 PP3381 WBMT
UniProtKB ID: O43709, A8K501, Q96P12, Q9BQ58, Q9HBP9
Gene ID:
Human(114049) Summary: This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011]
Mouse(66138) Williams Beuren syndrome chromosome region 22
Rat(368084) Williams Beuren syndrome chromosome region 22
Zebrafish(572367) Williams Beuren syndrome chromosome region 22
chicken(431053) Williams Beuren syndrome chromosome region 22
dog(479717) Williams Beuren syndrome chromosome region 22
domestic cat(101093160) Williams Beuren syndrome chromosome region 22
naked mole-rat(101702132) Williams Beuren syndrome chromosome region 22
domestic guinea pig(100725388) Williams Beuren syndrome chromosome region 22
cow(513878) Williams Beuren syndrome chromosome region 22
sheep(101112944) Williams Beuren syndrome chromosome region 22
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017528 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041491 MISSION® esiRNA esiRNA human WBSCR22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017528 Rosetta Predictions human pricing
XM_001071583 Rosetta Predictions rat pricing
XM_347254 Rosetta Predictions rat pricing
NM_025375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137521 predicted 743
2 SASI_Hs01_00137523 predicted 534
3 SASI_Hs01_00137524 predicted 383
4 SASI_Hs01_00137525 predicted 625
5 SASI_Hs01_00137526 predicted 316
6 SASI_Hs02_00350150 predicted 247
7 SASI_Hs01_00137527 predicted 219
8 SASI_Hs01_00137528 predicted 202
9 SASI_Hs01_00137530 predicted 674
10 SASI_Hs02_00350151 predicted 618
11 SASI_Hs01_00137522 predicted 258
12 SASI_Hs01_00137529 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335637 predicted 749
2 SASI_Rn02_00335638 predicted 232
3 SASI_Rn02_00335639 predicted 868
4 SASI_Rn02_00335640 predicted 839
5 SASI_Rn02_00335641 predicted 722
6 SASI_Rn02_00335642 predicted 224
7 SASI_Rn02_00335643 predicted 917
8 SASI_Rn02_00335644 predicted 925
9 SASI_Rn02_00335645 predicted 1005
10 SASI_Rn02_00335646 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399606 predicted 755
2 SASI_Rn02_00399607 predicted 223
3 SASI_Rn02_00399608 predicted 871
4 SASI_Rn02_00399609 predicted 840
5 SASI_Rn02_00399610 predicted 717
6 SASI_Rn02_00399611 predicted 219
7 SASI_Rn02_00399612 predicted 917
8 SASI_Rn02_00399613 predicted 926
9 SASI_Rn02_00399614 predicted 1008
10 SASI_Rn02_00399615 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131050 predicted 856
2 SASI_Mm01_00131051 predicted 244
3 SASI_Mm02_00328101 predicted 230
4 SASI_Mm01_00131052 predicted 791
5 SASI_Mm01_00131053 predicted 623
6 SASI_Mm01_00131054 predicted 831
7 SASI_Mm01_00131055 predicted 1025
8 SASI_Mm01_00131058 predicted 372
9 SASI_Mm02_00328102 predicted 887
10 SASI_Mm01_00131059 predicted 918
11 SASI_Mm01_00131056 predicted 1199
12 SASI_Mm01_00131057 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025375
VALIDATED
WBSCR22 MISSION shRNA Bacterial Glycerol Stock
Williams Beuren syndrome chromosome region 22
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025375.1-1441s1c1
Sequence:CCGGGCTCAGATCCTGTAATCCCAACTCGAGTTGGGATTACAGGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-940s1c1
Sequence:CCGGGCAAAGAAGTTCTACCTCTGTCTCGAGACAGAGGTAGAACTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-447s1c1
Sequence:CCGGGATTGACATCCAGACCAAGATCTCGAGATCTTGGTCTGGATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-550s1c1
Sequence:CCGGAGTGGAGATTATATCTCAGAACTCGAGTTCTGAGATATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-510s1c1
Sequence:CCGGGCCTTCTTACCTGTTAGACATCTCGAGATGTCTAACAGGTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-638s21c1
Sequence:CCGGGCAAAGAAGTTCTACCTCTGTCTCGAGACAGAGGTAGAACTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025375.2-145s21c1
Sequence:CCGGGATTGACATCCAGACCAAGATCTCGAGATCTTGGTCTGGATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-248s21c1
Sequence:CCGGAGTGGAGATTATATCTCAGAACTCGAGTTCTGAGATATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-208s21c1
Sequence:CCGGGCCTTCTTACCTGTTAGACATCTCGAGATGTCTAACAGGTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025375
VALIDATED
WBSCR22 MISSION shRNA shRNA Plasmid DNA
Williams Beuren syndrome chromosome region 22
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025375.1-1441s1c1
Sequence:CCGGGCTCAGATCCTGTAATCCCAACTCGAGTTGGGATTACAGGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-940s1c1
Sequence:CCGGGCAAAGAAGTTCTACCTCTGTCTCGAGACAGAGGTAGAACTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-447s1c1
Sequence:CCGGGATTGACATCCAGACCAAGATCTCGAGATCTTGGTCTGGATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-550s1c1
Sequence:CCGGAGTGGAGATTATATCTCAGAACTCGAGTTCTGAGATATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-510s1c1
Sequence:CCGGGCCTTCTTACCTGTTAGACATCTCGAGATGTCTAACAGGTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-638s21c1
Sequence:CCGGGCAAAGAAGTTCTACCTCTGTCTCGAGACAGAGGTAGAACTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025375.2-145s21c1
Sequence:CCGGGATTGACATCCAGACCAAGATCTCGAGATCTTGGTCTGGATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-248s21c1
Sequence:CCGGAGTGGAGATTATATCTCAGAACTCGAGTTCTGAGATATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-208s21c1
Sequence:CCGGGCCTTCTTACCTGTTAGACATCTCGAGATGTCTAACAGGTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025375
VALIDATED
WBSCR22 MISSION shRNA Lentiviral Transduction Particles
Williams Beuren syndrome chromosome region 22
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025375.1-1441s1c1
Sequence:CCGGGCTCAGATCCTGTAATCCCAACTCGAGTTGGGATTACAGGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-940s1c1
Sequence:CCGGGCAAAGAAGTTCTACCTCTGTCTCGAGACAGAGGTAGAACTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-447s1c1
Sequence:CCGGGATTGACATCCAGACCAAGATCTCGAGATCTTGGTCTGGATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-550s1c1
Sequence:CCGGAGTGGAGATTATATCTCAGAACTCGAGTTCTGAGATATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025375.1-510s1c1
Sequence:CCGGGCCTTCTTACCTGTTAGACATCTCGAGATGTCTAACAGGTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-638s21c1
Sequence:CCGGGCAAAGAAGTTCTACCTCTGTCTCGAGACAGAGGTAGAACTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025375.2-145s21c1
Sequence:CCGGGATTGACATCCAGACCAAGATCTCGAGATCTTGGTCTGGATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-248s21c1
Sequence:CCGGAGTGGAGATTATATCTCAGAACTCGAGTTCTGAGATATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025375.2-208s21c1
Sequence:CCGGGCCTTCTTACCTGTTAGACATCTCGAGATGTCTAACAGGTAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017528
VALIDATED
WBSCR22 MISSION shRNA Bacterial Glycerol Stock
Williams Beuren syndrome chromosome region 22
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-637s1c1
Sequence:CCGGCAGTGCCAAAGCAAAGAAATTCTCGAGAATTTCTTTGCTTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017528.2-154s1c1
Sequence:CCGGGATTGATATCCAGACCAGGATCTCGAGATCCTGGTCTGGATATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-128s1c1
Sequence:CCGGCGGAAATACGTTCGCAACTCACTCGAGTGAGTTGCGAACGTATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017528.2-205s1c1
Sequence:CCGGGCCAGAGAATAAGCCCTGTTACTCGAGTAACAGGGCTTATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-626s1c1
Sequence:CCGGGACTACCCTAACAGTGCCAAACTCGAGTTTGGCACTGTTAGGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-137s1c1
Sequence:CCGGGTTCGCAACTCACGGATGATTCTCGAGAATCATCCGTGAGTTGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-137s21c1
Sequence:CCGGGTTCGCAACTCACGGATGATTCTCGAGAATCATCCGTGAGTTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-219s21c1
Sequence:CCGGCCTGTTACCTGCTGGATATTGCTCGAGCAATATCCAGCAGGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017528.2-956s21c1
Sequence:CCGGTCAGCTGACAAAGTAGTATTTCTCGAGAAATACTACTTTGTCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-637s21c1
Sequence:CCGGCAGTGCCAAAGCAAAGAAATTCTCGAGAATTTCTTTGCTTTGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-626s21c1
Sequence:CCGGGACTACCCTAACAGTGCCAAACTCGAGTTTGGCACTGTTAGGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017528
VALIDATED
WBSCR22 MISSION shRNA shRNA Plasmid DNA
Williams Beuren syndrome chromosome region 22
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-637s1c1
Sequence:CCGGCAGTGCCAAAGCAAAGAAATTCTCGAGAATTTCTTTGCTTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017528.2-154s1c1
Sequence:CCGGGATTGATATCCAGACCAGGATCTCGAGATCCTGGTCTGGATATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-128s1c1
Sequence:CCGGCGGAAATACGTTCGCAACTCACTCGAGTGAGTTGCGAACGTATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017528.2-205s1c1
Sequence:CCGGGCCAGAGAATAAGCCCTGTTACTCGAGTAACAGGGCTTATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-626s1c1
Sequence:CCGGGACTACCCTAACAGTGCCAAACTCGAGTTTGGCACTGTTAGGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-137s1c1
Sequence:CCGGGTTCGCAACTCACGGATGATTCTCGAGAATCATCCGTGAGTTGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-137s21c1
Sequence:CCGGGTTCGCAACTCACGGATGATTCTCGAGAATCATCCGTGAGTTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-219s21c1
Sequence:CCGGCCTGTTACCTGCTGGATATTGCTCGAGCAATATCCAGCAGGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017528.2-956s21c1
Sequence:CCGGTCAGCTGACAAAGTAGTATTTCTCGAGAAATACTACTTTGTCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-637s21c1
Sequence:CCGGCAGTGCCAAAGCAAAGAAATTCTCGAGAATTTCTTTGCTTTGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-626s21c1
Sequence:CCGGGACTACCCTAACAGTGCCAAACTCGAGTTTGGCACTGTTAGGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017528
VALIDATED
WBSCR22 MISSION shRNA Lentiviral Transduction Particles
Williams Beuren syndrome chromosome region 22
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-637s1c1
Sequence:CCGGCAGTGCCAAAGCAAAGAAATTCTCGAGAATTTCTTTGCTTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017528.2-154s1c1
Sequence:CCGGGATTGATATCCAGACCAGGATCTCGAGATCCTGGTCTGGATATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-128s1c1
Sequence:CCGGCGGAAATACGTTCGCAACTCACTCGAGTGAGTTGCGAACGTATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017528.2-205s1c1
Sequence:CCGGGCCAGAGAATAAGCCCTGTTACTCGAGTAACAGGGCTTATTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-626s1c1
Sequence:CCGGGACTACCCTAACAGTGCCAAACTCGAGTTTGGCACTGTTAGGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017528.2-137s1c1
Sequence:CCGGGTTCGCAACTCACGGATGATTCTCGAGAATCATCCGTGAGTTGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-137s21c1
Sequence:CCGGGTTCGCAACTCACGGATGATTCTCGAGAATCATCCGTGAGTTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-219s21c1
Sequence:CCGGCCTGTTACCTGCTGGATATTGCTCGAGCAATATCCAGCAGGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017528.2-956s21c1
Sequence:CCGGTCAGCTGACAAAGTAGTATTTCTCGAGAAATACTACTTTGTCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-637s21c1
Sequence:CCGGCAGTGCCAAAGCAAAGAAATTCTCGAGAATTTCTTTGCTTTGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017528.2-626s21c1
Sequence:CCGGGACTACCCTAACAGTGCCAAACTCGAGTTTGGCACTGTTAGGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks