EMAIL THIS PAGE TO A FRIEND

WBSCR27

Williams Beuren syndrome chromosome region 27

UniProtKB ID: Q8N6F8
Gene ID:
Human(155368) Summary: This gene encodes a protein belonging to ubiE/COQ5 methyltransferase family. The gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.22-q11.23. [provided by RefSeq, Jul 2008]
Mouse(79565) Williams Beuren syndrome chromosome region 27 (human)
Rat(688407) Williams Beuren syndrome chromosome region 27
cow(509616) Williams Beuren syndrome chromosome region 27
sheep(101111931) Williams Beuren syndrome chromosome region 27
domestic guinea pig(100726116) Williams Beuren syndrome chromosome region 27
naked mole-rat(101715994) Williams Beuren syndrome chromosome region 27
Zebrafish(678636) Williams Beuren syndrome chromosome region 27
domestic cat(101093659) Williams Beuren syndrome chromosome region 27
chicken(770708) Williams Beuren syndrome chromosome region 27
dog(489801) Williams Beuren syndrome chromosome region 27
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130361 MISSION® esiRNA esiRNA human WBSCR27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152559 Rosetta Predictions human pricing
NM_001109499 Rosetta Predictions rat pricing
NM_024479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130481 predicted 427
2 SASI_Hs01_00130482 predicted 426
3 SASI_Hs01_00130483 predicted 540
4 SASI_Hs01_00130484 predicted 537
5 SASI_Hs01_00130485 predicted 543
6 SASI_Hs02_00366375 predicted 444
7 SASI_Hs01_00130486 predicted 542
8 SASI_Hs01_00130487 predicted 544
9 SASI_Hs01_00130488 predicted 200
10 SASI_Hs01_00130489 predicted 244
11 SASI_Hs01_00130490 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248999 predicted 1047
2 SASI_Rn02_00249000 predicted 782
3 SASI_Rn02_00249001 predicted 395
4 SASI_Rn02_00249002 predicted 955
5 SASI_Rn02_00249003 predicted 956
6 SASI_Rn02_00249004 predicted 434
7 SASI_Rn02_00249005 predicted 1136
8 SASI_Rn02_00249006 predicted 1035
9 SASI_Rn02_00249007 predicted 785
10 SASI_Rn02_00249008 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051927 predicted 525
2 SASI_Mm01_00051928 predicted 1139
3 SASI_Mm01_00051929 predicted 210
4 SASI_Mm01_00051930 predicted 257
5 SASI_Mm01_00051932 predicted 611
6 SASI_Mm01_00051933 predicted 910
7 SASI_Mm01_00051934 predicted 981
8 SASI_Mm01_00051935 predicted 624
9 SASI_Mm02_00327861 predicted 840
10 SASI_Mm01_00051936 predicted 837
11 SASI_Mm01_00051931 predicted 901
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152559
WBSCR27 MISSION shRNA Bacterial Glycerol Stock
Williams Beuren syndrome chromosome region 27
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-761s21c1
Sequence:CCGGCCCAGGTTGAGGAAGTGAGATCTCGAGATCTCACTTCCTCAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-486s21c1
Sequence:CCGGATGCGATACCTGAGCTACATGCTCGAGCATGTAGCTCAGGTATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-547s21c1
Sequence:CCGGCAACTCGTCCAACCTTCAATACTCGAGTATTGAAGGTTGGACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-702s21c1
Sequence:CCGGCTCTGCCAAGGATGGCTTCATCTCGAGATGAAGCCATCCTTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-731s21c1
Sequence:CCGGTTGTCTACCTGTACCGAAAGTCTCGAGACTTTCGGTACAGGTAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-550s1c1
Sequence:CCGGCTCGTCCAACCTTCAATACAACTCGAGTTGTATTGAAGGTTGGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-728s1c1
Sequence:CCGGGCATTGTCTACCTGTACCGAACTCGAGTTCGGTACAGGTAGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-717s1c1
Sequence:CCGGCTTCATCTCCGGCATTGTCTACTCGAGTAGACAATGCCGGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-553s1c1
Sequence:CCGGGTCCAACCTTCAATACAAGGACTCGAGTCCTTGTATTGAAGGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-729s1c1
Sequence:CCGGCATTGTCTACCTGTACCGAAACTCGAGTTTCGGTACAGGTAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-484s1c1
Sequence:CCGGCAATGCGATACCTGAGCTACACTCGAGTGTAGCTCAGGTATCGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152559
WBSCR27 MISSION shRNA shRNA Plasmid DNA
Williams Beuren syndrome chromosome region 27
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-761s21c1
Sequence:CCGGCCCAGGTTGAGGAAGTGAGATCTCGAGATCTCACTTCCTCAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-486s21c1
Sequence:CCGGATGCGATACCTGAGCTACATGCTCGAGCATGTAGCTCAGGTATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-547s21c1
Sequence:CCGGCAACTCGTCCAACCTTCAATACTCGAGTATTGAAGGTTGGACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-702s21c1
Sequence:CCGGCTCTGCCAAGGATGGCTTCATCTCGAGATGAAGCCATCCTTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-731s21c1
Sequence:CCGGTTGTCTACCTGTACCGAAAGTCTCGAGACTTTCGGTACAGGTAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-550s1c1
Sequence:CCGGCTCGTCCAACCTTCAATACAACTCGAGTTGTATTGAAGGTTGGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-728s1c1
Sequence:CCGGGCATTGTCTACCTGTACCGAACTCGAGTTCGGTACAGGTAGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-717s1c1
Sequence:CCGGCTTCATCTCCGGCATTGTCTACTCGAGTAGACAATGCCGGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-553s1c1
Sequence:CCGGGTCCAACCTTCAATACAAGGACTCGAGTCCTTGTATTGAAGGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-729s1c1
Sequence:CCGGCATTGTCTACCTGTACCGAAACTCGAGTTTCGGTACAGGTAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-484s1c1
Sequence:CCGGCAATGCGATACCTGAGCTACACTCGAGTGTAGCTCAGGTATCGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152559
WBSCR27 MISSION shRNA Lentiviral Transduction Particles
Williams Beuren syndrome chromosome region 27
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-761s21c1
Sequence:CCGGCCCAGGTTGAGGAAGTGAGATCTCGAGATCTCACTTCCTCAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-486s21c1
Sequence:CCGGATGCGATACCTGAGCTACATGCTCGAGCATGTAGCTCAGGTATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-547s21c1
Sequence:CCGGCAACTCGTCCAACCTTCAATACTCGAGTATTGAAGGTTGGACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-702s21c1
Sequence:CCGGCTCTGCCAAGGATGGCTTCATCTCGAGATGAAGCCATCCTTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152559.2-731s21c1
Sequence:CCGGTTGTCTACCTGTACCGAAAGTCTCGAGACTTTCGGTACAGGTAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-550s1c1
Sequence:CCGGCTCGTCCAACCTTCAATACAACTCGAGTTGTATTGAAGGTTGGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-728s1c1
Sequence:CCGGGCATTGTCTACCTGTACCGAACTCGAGTTCGGTACAGGTAGACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-717s1c1
Sequence:CCGGCTTCATCTCCGGCATTGTCTACTCGAGTAGACAATGCCGGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-553s1c1
Sequence:CCGGGTCCAACCTTCAATACAAGGACTCGAGTCCTTGTATTGAAGGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-729s1c1
Sequence:CCGGCATTGTCTACCTGTACCGAAACTCGAGTTTCGGTACAGGTAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152559.2-484s1c1
Sequence:CCGGCAATGCGATACCTGAGCTACACTCGAGTGTAGCTCAGGTATCGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024479
WBSCR27 MISSION shRNA Bacterial Glycerol Stock
Williams Beuren syndrome chromosome region 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-659s1c1
Sequence:CCGGCCAACCTTCCATACAAGGAGACTCGAGTCTCCTTGTATGGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-816s1c1
Sequence:CCGGCTCTGGCATCATCTACCTTTACTCGAGTAAAGGTAGATGATGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-217s1c1
Sequence:CCGGGCCTGCAAGCTCCGCTTCTATCTCGAGATAGAAGCGGAGCTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-307s1c1
Sequence:CCGGGATTGTCTCAGTCGAGCCTTTCTCGAGAAAGGCTCGACTGAGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024479.2-1125s1c1
Sequence:CCGGCCACATACAAATCACAGGTTTCTCGAGAAACCTGTGATTTGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024479
WBSCR27 MISSION shRNA shRNA Plasmid DNA
Williams Beuren syndrome chromosome region 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-659s1c1
Sequence:CCGGCCAACCTTCCATACAAGGAGACTCGAGTCTCCTTGTATGGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-816s1c1
Sequence:CCGGCTCTGGCATCATCTACCTTTACTCGAGTAAAGGTAGATGATGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-217s1c1
Sequence:CCGGGCCTGCAAGCTCCGCTTCTATCTCGAGATAGAAGCGGAGCTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-307s1c1
Sequence:CCGGGATTGTCTCAGTCGAGCCTTTCTCGAGAAAGGCTCGACTGAGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024479.2-1125s1c1
Sequence:CCGGCCACATACAAATCACAGGTTTCTCGAGAAACCTGTGATTTGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024479
WBSCR27 MISSION shRNA Lentiviral Transduction Particles
Williams Beuren syndrome chromosome region 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-659s1c1
Sequence:CCGGCCAACCTTCCATACAAGGAGACTCGAGTCTCCTTGTATGGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-816s1c1
Sequence:CCGGCTCTGGCATCATCTACCTTTACTCGAGTAAAGGTAGATGATGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-217s1c1
Sequence:CCGGGCCTGCAAGCTCCGCTTCTATCTCGAGATAGAAGCGGAGCTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024479.2-307s1c1
Sequence:CCGGGATTGTCTCAGTCGAGCCTTTCTCGAGAAAGGCTCGACTGAGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024479.2-1125s1c1
Sequence:CCGGCCACATACAAATCACAGGTTTCTCGAGAAACCTGTGATTTGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks