EMAIL THIS PAGE TO A FRIEND

WBSCR28

Williams-Beuren syndrome chromosome region 28

UniProtKB ID: Q6UE05, Q6UE04, Q8NHP4
Gene ID:
Mouse(76629) Williams-Beuren syndrome chromosome region 28 (human)
Rat(288604) Williams-Beuren syndrome chromosome region 28
domestic cat(101097611) Williams-Beuren syndrome chromosome region 28
dog(607781) Williams-Beuren syndrome chromosome region 28
naked mole-rat(101715658) Williams-Beuren syndrome chromosome region 28
cow(617180) Williams-Beuren syndrome chromosome region 28
sheep(101111420) Williams-Beuren syndrome chromosome region 28
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182504 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182504 Rosetta Predictions human pricing
XM_001077705 Rosetta Predictions rat pricing
XM_213758 Rosetta Predictions rat pricing
NM_029681 Rosetta Predictions mouse pricing
NM_194065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074493 predicted 540
2 SASI_Hs01_00074494 predicted 527
3 SASI_Hs02_00370562 predicted 436
4 SASI_Hs01_00074495 predicted 581
5 SASI_Hs01_00074496 predicted 586
6 SASI_Hs01_00074497 predicted 562
7 SASI_Hs01_00074498 predicted 588
8 SASI_Hs01_00074499 predicted 527
9 SASI_Hs01_00074500 predicted 555
10 SASI_Hs01_00074501 predicted 572
11 SASI_Hs01_00074502 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358189 predicted 484
2 SASI_Rn02_00358190 predicted 271
3 SASI_Rn02_00358191 predicted 222
4 SASI_Rn02_00358192 predicted 573
5 SASI_Rn02_00358193 predicted 340
6 SASI_Rn02_00358194 predicted 414
7 SASI_Rn02_00358195 predicted 474
8 SASI_Rn02_00358196 predicted 566
9 SASI_Rn02_00358197 predicted 239
10 SASI_Rn02_00358198 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374896 predicted 487
2 SASI_Rn02_00374897 predicted 280
3 SASI_Rn02_00374898 predicted 222
4 SASI_Rn02_00374899 predicted 579
5 SASI_Rn02_00374900 predicted 337
6 SASI_Rn02_00374901 predicted 418
7 SASI_Rn02_00374902 predicted 472
8 SASI_Rn02_00374903 predicted 564
9 SASI_Rn02_00374904 predicted 238
10 SASI_Rn02_00374905 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069128 predicted 235
2 SASI_Mm01_00069129 predicted 256
3 SASI_Mm01_00069130 predicted 255
4 SASI_Mm01_00069131 predicted 254
5 SASI_Mm01_00069132 predicted 219
6 SASI_Mm01_00069133 predicted 210
7 SASI_Mm01_00069134 predicted 226
8 SASI_Mm01_00069135 predicted 225
9 SASI_Mm01_00069136 predicted 314
10 SASI_Mm01_00069137 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038642 predicted 238
2 SASI_Mm01_00038643 predicted 258
3 SASI_Mm01_00038644 predicted 254
4 SASI_Mm01_00038645 predicted 254
5 SASI_Mm01_00038646 predicted 215
6 SASI_Mm01_00038647 predicted 211
7 SASI_Mm01_00038648 predicted 222
8 SASI_Mm01_00038649 predicted 222
9 SASI_Mm01_00038650 predicted 312
10 SASI_Mm01_00038651 predicted 221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029681
WBSCR28 MISSION shRNA Bacterial Glycerol Stock
Williams-Beuren syndrome chromosome region 28
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029681.1-758s1c1
Sequence:CCGGCTGCTTCAAGCTGCCTTTGAACTCGAGTTCAAAGGCAGCTTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-231s1c1
Sequence:CCGGCCGGAAGTCATCATAACCTGTCTCGAGACAGGTTATGATGACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-506s1c1
Sequence:CCGGGAAAGCCCATCACTTTAGTCTCTCGAGAGACTAAAGTGATGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-500s1c1
Sequence:CCGGGATGCAGAAAGCCCATCACTTCTCGAGAAGTGATGGGCTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-234s1c1
Sequence:CCGGGAAGTCATCATAACCTGTGCTCTCGAGAGCACAGGTTATGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029681.1-242s1c1
Sequence:CCGGCATAACCTGTGCTCTGAGTTTCTCGAGAAACTCAGAGCACAGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029681
WBSCR28 MISSION shRNA shRNA Plasmid DNA
Williams-Beuren syndrome chromosome region 28
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029681.1-758s1c1
Sequence:CCGGCTGCTTCAAGCTGCCTTTGAACTCGAGTTCAAAGGCAGCTTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-231s1c1
Sequence:CCGGCCGGAAGTCATCATAACCTGTCTCGAGACAGGTTATGATGACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-506s1c1
Sequence:CCGGGAAAGCCCATCACTTTAGTCTCTCGAGAGACTAAAGTGATGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-500s1c1
Sequence:CCGGGATGCAGAAAGCCCATCACTTCTCGAGAAGTGATGGGCTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-234s1c1
Sequence:CCGGGAAGTCATCATAACCTGTGCTCTCGAGAGCACAGGTTATGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029681.1-242s1c1
Sequence:CCGGCATAACCTGTGCTCTGAGTTTCTCGAGAAACTCAGAGCACAGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029681
WBSCR28 MISSION shRNA Lentiviral Transduction Particles
Williams-Beuren syndrome chromosome region 28
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029681.1-758s1c1
Sequence:CCGGCTGCTTCAAGCTGCCTTTGAACTCGAGTTCAAAGGCAGCTTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-231s1c1
Sequence:CCGGCCGGAAGTCATCATAACCTGTCTCGAGACAGGTTATGATGACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-506s1c1
Sequence:CCGGGAAAGCCCATCACTTTAGTCTCTCGAGAGACTAAAGTGATGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-500s1c1
Sequence:CCGGGATGCAGAAAGCCCATCACTTCTCGAGAAGTGATGGGCTTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029681.1-234s1c1
Sequence:CCGGGAAGTCATCATAACCTGTGCTCTCGAGAGCACAGGTTATGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029681.1-242s1c1
Sequence:CCGGCATAACCTGTGCTCTGAGTTTCTCGAGAAACTCAGAGCACAGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182504
WBSCR28 MISSION shRNA Bacterial Glycerol Stock
Williams-Beuren syndrome chromosome region 28
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-117s1c1
Sequence:CCGGGAACCGAGATCACCTCTATAACTCGAGTTATAGAGGTGATCTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-638s1c1
Sequence:CCGGCCTATCTCATCACTTGGACCACTCGAGTGGTCCAAGTGATGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-531s1c1
Sequence:CCGGCAGTAAGGCCTTGCAAGTGAACTCGAGTTCACTTGCAAGGCCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-409s1c1
Sequence:CCGGGCCATCTGGACAGATCTGTTTCTCGAGAAACAGATCTGTCCAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-150s1c1
Sequence:CCGGCAAGATCAACCTCTTCAACCACTCGAGTGGTTGAAGAGGTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182504.3-594s21c1
Sequence:CCGGTTGGTGGGTGGAGACTATGACCTCGAGGTCATAGTCTCCACCCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182504.3-543s21c1
Sequence:CCGGGCAAGTGAACTGCGTGGTAAGCTCGAGCTTACCACGCAGTTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182504
WBSCR28 MISSION shRNA shRNA Plasmid DNA
Williams-Beuren syndrome chromosome region 28
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-117s1c1
Sequence:CCGGGAACCGAGATCACCTCTATAACTCGAGTTATAGAGGTGATCTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-638s1c1
Sequence:CCGGCCTATCTCATCACTTGGACCACTCGAGTGGTCCAAGTGATGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-531s1c1
Sequence:CCGGCAGTAAGGCCTTGCAAGTGAACTCGAGTTCACTTGCAAGGCCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-409s1c1
Sequence:CCGGGCCATCTGGACAGATCTGTTTCTCGAGAAACAGATCTGTCCAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-150s1c1
Sequence:CCGGCAAGATCAACCTCTTCAACCACTCGAGTGGTTGAAGAGGTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182504.3-594s21c1
Sequence:CCGGTTGGTGGGTGGAGACTATGACCTCGAGGTCATAGTCTCCACCCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182504.3-543s21c1
Sequence:CCGGGCAAGTGAACTGCGTGGTAAGCTCGAGCTTACCACGCAGTTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182504
WBSCR28 MISSION shRNA Lentiviral Transduction Particles
Williams-Beuren syndrome chromosome region 28
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-117s1c1
Sequence:CCGGGAACCGAGATCACCTCTATAACTCGAGTTATAGAGGTGATCTCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-638s1c1
Sequence:CCGGCCTATCTCATCACTTGGACCACTCGAGTGGTCCAAGTGATGAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-531s1c1
Sequence:CCGGCAGTAAGGCCTTGCAAGTGAACTCGAGTTCACTTGCAAGGCCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-409s1c1
Sequence:CCGGGCCATCTGGACAGATCTGTTTCTCGAGAAACAGATCTGTCCAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182504.2-150s1c1
Sequence:CCGGCAAGATCAACCTCTTCAACCACTCGAGTGGTTGAAGAGGTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182504.3-594s21c1
Sequence:CCGGTTGGTGGGTGGAGACTATGACCTCGAGGTCATAGTCTCCACCCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182504.3-543s21c1
Sequence:CCGGGCAAGTGAACTGCGTGGTAAGCTCGAGCTTACCACGCAGTTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks