EMAIL THIS PAGE TO A FRIEND

WDFY1

WD repeat and FYVE domain containing 1

Synonyms: FENS-1 WDF1 ZFYVE17
UniProtKB ID: Q8IWB7, Q53S17, Q9H9D5, Q9P2B3
Gene ID:
Human(57590) Summary: The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate (PtdIns(3)P)-containing membranes. This gene encodes a protein which contains a single FYVE domain and multiple WD40 repeats. This protein is localized to endosomes. [provided by RefSeq, Jul 2008]
Mouse(69368) WD repeat and FYVE domain containing 1
Rat(301549) WD repeat and FYVE domain containing 1
Zebrafish(474326) WD repeat and FYVE domain containing 1
dog(488552) WD repeat and FYVE domain containing 1
Horse(100061271) WD repeat and FYVE domain containing 1
domestic cat(101084981) WD repeat and FYVE domain containing 1
chicken(424806) WD repeat and FYVE domain containing 1
cow(614729) WD repeat and FYVE domain containing 1
sheep(101121495) WD repeat and FYVE domain containing 1
Goat(100861160) WD repeat and FYVE domain containing 1
domestic guinea pig(100718645) WD repeat and FYVE domain containing 1
naked mole-rat(101698444) WD repeat and FYVE domain containing 1
Domestic Rabbit(100337726) WD repeat and FYVE domain containing 1
202 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074331 MISSION® esiRNA esiRNA human WDFY1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020830 Rosetta Predictions human pricing
NM_001008331 Rosetta Predictions rat pricing
XM_001060156 Rosetta Predictions rat pricing
NM_001111279 Rosetta Predictions mouse pricing
NM_027057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178625 predicted 290
2 SASI_Hs01_00178626 predicted 669
3 SASI_Hs01_00178627 predicted 291
4 SASI_Hs01_00178628 predicted 670
5 SASI_Hs01_00178629 predicted 553
6 SASI_Hs01_00178630 predicted 1205
7 SASI_Hs01_00178631 predicted 484
8 SASI_Hs01_00178632 predicted 885
9 SASI_Hs01_00178633 predicted 848
10 SASI_Hs01_00178634 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042014 predicted 496
2 SASI_Rn01_00042016 predicted 449
3 SASI_Rn01_00042017 predicted 985
4 SASI_Rn01_00042018 predicted 1028
5 SASI_Rn01_00042019 predicted 599
6 SASI_Rn02_00199074 predicted 440
7 SASI_Rn01_00042020 predicted 979
8 SASI_Rn01_00042021 predicted 703
9 SASI_Rn01_00042022 predicted 477
10 SASI_Rn01_00042023 predicted 1009
11 SASI_Rn01_00042015 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295528 predicted 451
2 SASI_Rn02_00295529 predicted 403
3 SASI_Rn02_00295530 predicted 556
4 SASI_Rn02_00295531 predicted 653
5 SASI_Rn02_00295532 predicted 558
6 SASI_Rn02_00295533 predicted 429
7 SASI_Rn02_00295534 predicted 247
8 SASI_Rn02_00295535 predicted 722
9 SASI_Rn02_00295536 predicted 443
10 SASI_Rn02_00295537 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306642 predicted 233
2 SASI_Mm02_00306643 predicted 275
3 SASI_Mm02_00306644 predicted 312
4 SASI_Mm02_00306645 predicted 307
5 SASI_Mm02_00306646 predicted 207
6 SASI_Mm02_00306647 predicted 312
7 SASI_Mm02_00306648 predicted 298
8 SASI_Mm02_00306649 predicted 206
9 SASI_Mm02_00306650 predicted 307
10 SASI_Mm02_00306651 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331465 predicted 232
2 SASI_Mm01_00088097 predicted 270
3 SASI_Mm02_00331466 predicted 305
4 SASI_Mm01_00088099 predicted 308
5 SASI_Mm02_00331467 predicted 203
6 SASI_Mm02_00331468 predicted 308
7 SASI_Mm02_00331469 predicted 294
8 SASI_Mm02_00331470 predicted 206
9 SASI_Mm01_00088103 predicted 306
10 SASI_Mm01_00088104 predicted 301
11 SASI_Mm01_00088096 predicted 303
12 SASI_Mm01_00088098 predicted 374
13 SASI_Mm01_00088100 predicted 374
14 SASI_Mm01_00088101 predicted 402
15 SASI_Mm01_00088102 predicted 266
16 SASI_Mm01_00088105 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027057
VALIDATED
WDFY1 MISSION shRNA Bacterial Glycerol Stock
WD repeat and FYVE domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-300s21c1
Sequence:CCGGCCACGACAGCAGGCGGATATTCTCGAGAATATCCGCCTGCTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-340s21c1
Sequence:CCGGGCTGTGATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-414s21c1
Sequence:CCGGCCGCGTGTCTGCTATCATCTTCTCGAGAAGATGATAGCAGACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-208s21c1
Sequence:CCGGACCATCCGAGTATGGCTGAAACTCGAGTTTCAGCCATACTCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-313s21c1
Sequence:CCGGCGGATATTTGTGGGCCAGGATCTCGAGATCCTGGCCCACAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-264s1c1
Sequence:CCGGCCACGACAGCAGGCGGATATTCTCGAGAATATCCGCCTGCTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-277s1c1
Sequence:CCGGCGGATATTTGTGGGCCAGGATCTCGAGATCCTGGCCCACAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-172s1c1
Sequence:CCGGACCATCCGAGTATGGCTGAAACTCGAGTTTCAGCCATACTCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-378s1c1
Sequence:CCGGCCGCGTGTCTGCTATCATCTTCTCGAGAAGATGATAGCAGACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-304s1c1
Sequence:CCGGGCTGTGATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027057
VALIDATED
WDFY1 MISSION shRNA shRNA Plasmid DNA
WD repeat and FYVE domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-300s21c1
Sequence:CCGGCCACGACAGCAGGCGGATATTCTCGAGAATATCCGCCTGCTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-340s21c1
Sequence:CCGGGCTGTGATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-414s21c1
Sequence:CCGGCCGCGTGTCTGCTATCATCTTCTCGAGAAGATGATAGCAGACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-208s21c1
Sequence:CCGGACCATCCGAGTATGGCTGAAACTCGAGTTTCAGCCATACTCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-313s21c1
Sequence:CCGGCGGATATTTGTGGGCCAGGATCTCGAGATCCTGGCCCACAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-264s1c1
Sequence:CCGGCCACGACAGCAGGCGGATATTCTCGAGAATATCCGCCTGCTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-277s1c1
Sequence:CCGGCGGATATTTGTGGGCCAGGATCTCGAGATCCTGGCCCACAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-172s1c1
Sequence:CCGGACCATCCGAGTATGGCTGAAACTCGAGTTTCAGCCATACTCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-378s1c1
Sequence:CCGGCCGCGTGTCTGCTATCATCTTCTCGAGAAGATGATAGCAGACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-304s1c1
Sequence:CCGGGCTGTGATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027057
VALIDATED
WDFY1 MISSION shRNA Lentiviral Transduction Particles
WD repeat and FYVE domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-300s21c1
Sequence:CCGGCCACGACAGCAGGCGGATATTCTCGAGAATATCCGCCTGCTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-340s21c1
Sequence:CCGGGCTGTGATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-414s21c1
Sequence:CCGGCCGCGTGTCTGCTATCATCTTCTCGAGAAGATGATAGCAGACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-208s21c1
Sequence:CCGGACCATCCGAGTATGGCTGAAACTCGAGTTTCAGCCATACTCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027057.3-313s21c1
Sequence:CCGGCGGATATTTGTGGGCCAGGATCTCGAGATCCTGGCCCACAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-264s1c1
Sequence:CCGGCCACGACAGCAGGCGGATATTCTCGAGAATATCCGCCTGCTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-277s1c1
Sequence:CCGGCGGATATTTGTGGGCCAGGATCTCGAGATCCTGGCCCACAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-172s1c1
Sequence:CCGGACCATCCGAGTATGGCTGAAACTCGAGTTTCAGCCATACTCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-378s1c1
Sequence:CCGGCCGCGTGTCTGCTATCATCTTCTCGAGAAGATGATAGCAGACACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027057.1-304s1c1
Sequence:CCGGGCTGTGATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020830
VALIDATED
WDFY1 MISSION shRNA Bacterial Glycerol Stock
WD repeat and FYVE domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-284s21c1
Sequence:CCGGATGACAGCAGACGGATATTTGCTCGAGCAAATATCCGTCTGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-407s21c1
Sequence:CCGGCGATTATCTTCAGCTTGGCCACTCGAGTGGCCAAGCTGAAGATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-322s21c1
Sequence:CCGGGCTGTAATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-1027s21c1
Sequence:CCGGAGCAGCAAGCGCTCAAGTTACCTCGAGGTAACTTGAGCGCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-520s21c1
Sequence:CCGGTGGGCTTCGTGTCTGCAATATCTCGAGATATTGCAGACACGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020830
VALIDATED
WDFY1 MISSION shRNA shRNA Plasmid DNA
WD repeat and FYVE domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-284s21c1
Sequence:CCGGATGACAGCAGACGGATATTTGCTCGAGCAAATATCCGTCTGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-407s21c1
Sequence:CCGGCGATTATCTTCAGCTTGGCCACTCGAGTGGCCAAGCTGAAGATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-322s21c1
Sequence:CCGGGCTGTAATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-1027s21c1
Sequence:CCGGAGCAGCAAGCGCTCAAGTTACCTCGAGGTAACTTGAGCGCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-520s21c1
Sequence:CCGGTGGGCTTCGTGTCTGCAATATCTCGAGATATTGCAGACACGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020830
VALIDATED
WDFY1 MISSION shRNA Lentiviral Transduction Particles
WD repeat and FYVE domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-284s21c1
Sequence:CCGGATGACAGCAGACGGATATTTGCTCGAGCAAATATCCGTCTGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-407s21c1
Sequence:CCGGCGATTATCTTCAGCTTGGCCACTCGAGTGGCCAAGCTGAAGATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-322s21c1
Sequence:CCGGGCTGTAATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-1027s21c1
Sequence:CCGGAGCAGCAAGCGCTCAAGTTACCTCGAGGTAACTTGAGCGCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020830.3-520s21c1
Sequence:CCGGTGGGCTTCGTGTCTGCAATATCTCGAGATATTGCAGACACGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178350
VALIDATED
WDFY1 MISSION shRNA Bacterial Glycerol Stock
WD repeat and FYVE domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_178350.1-272s1c1
Sequence:CCGGCGATTATCTTCAGCTTGGCCACTCGAGTGGCCAAGCTGAAGATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-187s1c1
Sequence:CCGGGCTGTAATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-1080s1c1
Sequence:CCGGCATTGTAAAGATCTGGGACATCTCGAGATGTCCCAGATCTTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_178350.1-716s1c1
Sequence:CCGGCAGTGTGGAACATGGATGTTACTCGAGTAACATCCATGTTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178350.1-961s1c1
Sequence:CCGGGACTCCATCAAAGATGAAGATCTCGAGATCTTCATCTTTGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-420s1c1
Sequence:CCGGGTATGCTTTCGTTGGTGATTACTCGAGTAATCACCAACGAAAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178350
VALIDATED
WDFY1 MISSION shRNA shRNA Plasmid DNA
WD repeat and FYVE domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_178350.1-272s1c1
Sequence:CCGGCGATTATCTTCAGCTTGGCCACTCGAGTGGCCAAGCTGAAGATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-187s1c1
Sequence:CCGGGCTGTAATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-1080s1c1
Sequence:CCGGCATTGTAAAGATCTGGGACATCTCGAGATGTCCCAGATCTTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_178350.1-716s1c1
Sequence:CCGGCAGTGTGGAACATGGATGTTACTCGAGTAACATCCATGTTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178350.1-961s1c1
Sequence:CCGGGACTCCATCAAAGATGAAGATCTCGAGATCTTCATCTTTGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-420s1c1
Sequence:CCGGGTATGCTTTCGTTGGTGATTACTCGAGTAATCACCAACGAAAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178350
VALIDATED
WDFY1 MISSION shRNA Lentiviral Transduction Particles
WD repeat and FYVE domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_178350.1-272s1c1
Sequence:CCGGCGATTATCTTCAGCTTGGCCACTCGAGTGGCCAAGCTGAAGATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-187s1c1
Sequence:CCGGGCTGTAATGGAATTTCACGTTCTCGAGAACGTGAAATTCCATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-1080s1c1
Sequence:CCGGCATTGTAAAGATCTGGGACATCTCGAGATGTCCCAGATCTTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_178350.1-716s1c1
Sequence:CCGGCAGTGTGGAACATGGATGTTACTCGAGTAACATCCATGTTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178350.1-961s1c1
Sequence:CCGGGACTCCATCAAAGATGAAGATCTCGAGATCTTCATCTTTGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178350.1-420s1c1
Sequence:CCGGGTATGCTTTCGTTGGTGATTACTCGAGTAATCACCAACGAAAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks