EMAIL THIS PAGE TO A FRIEND

WDFY2

WD repeat and FYVE domain containing 2

Synonyms: PROF RP11-147H23.1 WDF2 ZFYVE22
UniProtKB ID: Q96P53, B1AL86, Q96CS1
Gene ID:
Human(115825) Summary: This gene encodes a protein that contains two WD domains and an FYVE zinc finger region. The function of this gene is unknown. An alternatively spliced transcript variant of this gene may exist. [provided by RefSeq, Jul 2008]
Mouse(268752) WD repeat and FYVE domain containing 2
Rat(305956) WD repeat and FYVE domain containing 2
Domestic Rabbit(100339595) WD repeat and FYVE domain containing 2
naked mole-rat(101715678) WD repeat and FYVE domain containing 2
domestic guinea pig(100731605) WD repeat and FYVE domain containing 2
cow(523432) WD repeat and FYVE domain containing 2
sheep(101106601) WD repeat and FYVE domain containing 2
Zebrafish(492636) WD repeat and FYVE domain containing 2
Horse(100049955) WD repeat and FYVE domain containing 2
domestic cat(101092480) WD repeat and FYVE domain containing 2
dog(606922) WD repeat and FYVE domain containing 2
chicken(770107) WD repeat and FYVE domain containing 2
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301888 Anti-WDFY2 affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB1303354 ANTI-WDFY2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing
SAB1408247 Anti-WDFY2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052950 Rosetta Predictions human pricing
NM_001107269 Rosetta Predictions rat pricing
NM_175546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361744 predicted 604
2 SASI_Hs01_00069955 predicted 644
3 SASI_Hs01_00069956 predicted 745
4 SASI_Hs02_00361745 predicted 1630
5 SASI_Hs01_00069957 predicted 1237
6 SASI_Hs02_00361746 predicted 1632
7 SASI_Hs02_00361747 predicted 617
8 SASI_Hs01_00069958 predicted 1422
9 SASI_Hs01_00069959 predicted 539
10 SASI_Hs02_00361748 predicted 1554
11 SASI_Hs01_00069954 predicted 1337
12 SASI_Hs01_00069960 predicted 1014
13 SASI_Hs01_00069961 predicted 531
14 SASI_Hs01_00069962 predicted 839
15 SASI_Hs01_00069963 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227175 predicted 1415
2 SASI_Rn02_00227176 predicted 1069
3 SASI_Rn02_00227177 predicted 1271
4 SASI_Rn02_00227178 predicted 811
5 SASI_Rn02_00227179 predicted 668
6 SASI_Rn02_00227180 predicted 1472
7 SASI_Rn02_00227181 predicted 1335
8 SASI_Rn02_00227182 predicted 699
9 SASI_Rn02_00227183 predicted 893
10 SASI_Rn02_00227184 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181585 predicted 1138
2 SASI_Mm01_00181586 predicted 1402
3 SASI_Mm01_00181587 predicted 961
4 SASI_Mm01_00181588 predicted 876
5 SASI_Mm01_00181589 predicted 740
6 SASI_Mm01_00181590 predicted 1324
7 SASI_Mm01_00181591 predicted 450
8 SASI_Mm01_00181592 predicted 1235
9 SASI_Mm01_00181593 predicted 769
10 SASI_Mm01_00181594 predicted 1388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052950
WDFY2 MISSION shRNA Bacterial Glycerol Stock
WD repeat and FYVE domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-525s1c1
Sequence:CCGGCAGAGTGACGATGATCCTGTTCTCGAGAACAGGATCATCGTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-843s1c1
Sequence:CCGGCTCTGTCATCATGTGGGACATCTCGAGATGTCCCACATGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-431s1c1
Sequence:CCGGCCATAGGTCTAGACAATGGTACTCGAGTACCATTGTCTAGACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-1074s1c1
Sequence:CCGGCAAGCAAATGTGGGACAGTAACTCGAGTTACTGTCCCACATTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-1310s1c1
Sequence:CCGGCCAGAGGATGGTTACTGACTTCTCGAGAAGTCAGTAACCATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052950.2-1450s1c1
Sequence:CCGGCCAGAGTGGTAAAGCAGACATCTCGAGATGTCTGCTTTACCACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-1228s1c1
Sequence:CCGGGCCATCACAGATGAAGAACGTCTCGAGACGTTCTTCATCTGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-1225s1c1
Sequence:CCGGGAGGCCATCACAGATGAAGAACTCGAGTTCTTCATCTGTGATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052950.3-1090s21c1
Sequence:CCGGTGCACAGCACACGCGACAATTCTCGAGAATTGTCGCGTGTGCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052950.3-1492s21c1
Sequence:CCGGTGGAACTGACAAGGTTATTAACTCGAGTTAATAACCTTGTCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052950.3-1555s21c1
Sequence:CCGGGGAATCAGAAAGATAGTATTTCTCGAGAAATACTATCTTTCTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052950
WDFY2 MISSION shRNA shRNA Plasmid DNA
WD repeat and FYVE domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-525s1c1
Sequence:CCGGCAGAGTGACGATGATCCTGTTCTCGAGAACAGGATCATCGTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-843s1c1
Sequence:CCGGCTCTGTCATCATGTGGGACATCTCGAGATGTCCCACATGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-431s1c1
Sequence:CCGGCCATAGGTCTAGACAATGGTACTCGAGTACCATTGTCTAGACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-1074s1c1
Sequence:CCGGCAAGCAAATGTGGGACAGTAACTCGAGTTACTGTCCCACATTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-1310s1c1
Sequence:CCGGCCAGAGGATGGTTACTGACTTCTCGAGAAGTCAGTAACCATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052950.2-1450s1c1
Sequence:CCGGCCAGAGTGGTAAAGCAGACATCTCGAGATGTCTGCTTTACCACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-1228s1c1
Sequence:CCGGGCCATCACAGATGAAGAACGTCTCGAGACGTTCTTCATCTGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-1225s1c1
Sequence:CCGGGAGGCCATCACAGATGAAGAACTCGAGTTCTTCATCTGTGATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052950.3-1090s21c1
Sequence:CCGGTGCACAGCACACGCGACAATTCTCGAGAATTGTCGCGTGTGCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052950.3-1492s21c1
Sequence:CCGGTGGAACTGACAAGGTTATTAACTCGAGTTAATAACCTTGTCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052950.3-1555s21c1
Sequence:CCGGGGAATCAGAAAGATAGTATTTCTCGAGAAATACTATCTTTCTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052950
WDFY2 MISSION shRNA Lentiviral Transduction Particles
WD repeat and FYVE domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-525s1c1
Sequence:CCGGCAGAGTGACGATGATCCTGTTCTCGAGAACAGGATCATCGTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-843s1c1
Sequence:CCGGCTCTGTCATCATGTGGGACATCTCGAGATGTCCCACATGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-431s1c1
Sequence:CCGGCCATAGGTCTAGACAATGGTACTCGAGTACCATTGTCTAGACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-1074s1c1
Sequence:CCGGCAAGCAAATGTGGGACAGTAACTCGAGTTACTGTCCCACATTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052950.2-1310s1c1
Sequence:CCGGCCAGAGGATGGTTACTGACTTCTCGAGAAGTCAGTAACCATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052950.2-1450s1c1
Sequence:CCGGCCAGAGTGGTAAAGCAGACATCTCGAGATGTCTGCTTTACCACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-1228s1c1
Sequence:CCGGGCCATCACAGATGAAGAACGTCTCGAGACGTTCTTCATCTGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052950.2-1225s1c1
Sequence:CCGGGAGGCCATCACAGATGAAGAACTCGAGTTCTTCATCTGTGATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052950.3-1090s21c1
Sequence:CCGGTGCACAGCACACGCGACAATTCTCGAGAATTGTCGCGTGTGCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052950.3-1492s21c1
Sequence:CCGGTGGAACTGACAAGGTTATTAACTCGAGTTAATAACCTTGTCAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052950.3-1555s21c1
Sequence:CCGGGGAATCAGAAAGATAGTATTTCTCGAGAAATACTATCTTTCTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175546
VALIDATED
WDFY2 MISSION shRNA Bacterial Glycerol Stock
WD repeat and FYVE domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-379s1c1
Sequence:CCGGCAGGACAGTTCGTGTTTGGTTCTCGAGAACCAAACACGAACTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-1392s1c1
Sequence:CCGGCTTCTGGAACTGACAAGGTAACTCGAGTTACCTTGTCAGTTCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-746s1c1
Sequence:CCGGCGTCATGTGTTTATTGGCGATCTCGAGATCGCCAATAAACACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-499s21c1
Sequence:CCGGGGTCTAGACAATGGTACAATCCTCGAGGATTGTACCATTGTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-1395s21c1
Sequence:CCGGTGGAACTGACAAGGTAATTAACTCGAGTTAATTACCTTGTCAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-329s21c1
Sequence:CCGGTGGCGGTGATTGTACCTAAAGCTCGAGCTTTAGGTACAATCACCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.3-499s1c1
Sequence:CCGGGGTCTAGACAATGGTACAATCCTCGAGGATTGTACCATTGTCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175546.3-1331s21c1
Sequence:CCGGATGACAGTAAGCATAACATTGCTCGAGCAATGTTATGCTTACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175546.3-1463s21c1
Sequence:CCGGTAGGAGACAGTGTCCCTGAAGCTCGAGCTTCAGGGACACTGTCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175546
VALIDATED
WDFY2 MISSION shRNA shRNA Plasmid DNA
WD repeat and FYVE domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-379s1c1
Sequence:CCGGCAGGACAGTTCGTGTTTGGTTCTCGAGAACCAAACACGAACTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-1392s1c1
Sequence:CCGGCTTCTGGAACTGACAAGGTAACTCGAGTTACCTTGTCAGTTCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-746s1c1
Sequence:CCGGCGTCATGTGTTTATTGGCGATCTCGAGATCGCCAATAAACACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-499s21c1
Sequence:CCGGGGTCTAGACAATGGTACAATCCTCGAGGATTGTACCATTGTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-1395s21c1
Sequence:CCGGTGGAACTGACAAGGTAATTAACTCGAGTTAATTACCTTGTCAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-329s21c1
Sequence:CCGGTGGCGGTGATTGTACCTAAAGCTCGAGCTTTAGGTACAATCACCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.3-499s1c1
Sequence:CCGGGGTCTAGACAATGGTACAATCCTCGAGGATTGTACCATTGTCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175546.3-1331s21c1
Sequence:CCGGATGACAGTAAGCATAACATTGCTCGAGCAATGTTATGCTTACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175546.3-1463s21c1
Sequence:CCGGTAGGAGACAGTGTCCCTGAAGCTCGAGCTTCAGGGACACTGTCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175546
VALIDATED
WDFY2 MISSION shRNA Lentiviral Transduction Particles
WD repeat and FYVE domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-379s1c1
Sequence:CCGGCAGGACAGTTCGTGTTTGGTTCTCGAGAACCAAACACGAACTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-1392s1c1
Sequence:CCGGCTTCTGGAACTGACAAGGTAACTCGAGTTACCTTGTCAGTTCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.2-746s1c1
Sequence:CCGGCGTCATGTGTTTATTGGCGATCTCGAGATCGCCAATAAACACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-499s21c1
Sequence:CCGGGGTCTAGACAATGGTACAATCCTCGAGGATTGTACCATTGTCTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-1395s21c1
Sequence:CCGGTGGAACTGACAAGGTAATTAACTCGAGTTAATTACCTTGTCAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_175546.3-329s21c1
Sequence:CCGGTGGCGGTGATTGTACCTAAAGCTCGAGCTTTAGGTACAATCACCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175546.3-499s1c1
Sequence:CCGGGGTCTAGACAATGGTACAATCCTCGAGGATTGTACCATTGTCTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175546.3-1331s21c1
Sequence:CCGGATGACAGTAAGCATAACATTGCTCGAGCAATGTTATGCTTACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175546.3-1463s21c1
Sequence:CCGGTAGGAGACAGTGTCCCTGAAGCTCGAGCTTCAGGGACACTGTCTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks