EMAIL THIS PAGE TO A FRIEND

WDFY3-AS2

WDFY3 antisense RNA 2

Synonyms: C4orf12 FBI4 NCRNA00247
Species: Human WDFY3-AS2(404201)
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205857 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205857 Rosetta Predictions human pricing
NR_015359 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089701 predicted 672
2 SASI_Hs01_00089702 predicted 769
3 SASI_Hs01_00089703 predicted 660
4 SASI_Hs01_00089704 predicted 550
5 SASI_Hs01_00089705 predicted 769
6 SASI_Hs01_00089706 predicted 318
7 SASI_Hs01_00089707 predicted 806
8 SASI_Hs01_00089708 predicted 592
9 SASI_Hs01_00089709 predicted 362
10 SASI_Hs01_00089710 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381192 predicted 1229
2 SASI_Hs02_00381193 predicted 312
3 SASI_Hs02_00381194 predicted 405
4 SASI_Hs02_00381195 predicted 313
5 SASI_Hs02_00381196 predicted 1380
6 SASI_Hs02_00381197 predicted 1380
7 SASI_Hs02_00381198 predicted 1351
8 SASI_Hs02_00381199 predicted 406
9 SASI_Hs02_00381200 predicted 1344
10 SASI_Hs02_00381201 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205857
WDFY3-AS2 MISSION shRNA Bacterial Glycerol Stock
WDFY3 antisense RNA 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-250s1c1
Sequence:CCGGGTGGCCATCTTTAATCCTCCTCTCGAGAGGAGGATTAAAGATGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-254s1c1
Sequence:CCGGCCATCTTTAATCCTCCTCCTCCTCGAGGAGGAGGAGGATTAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-163s1c1
Sequence:CCGGCGGGTTTCTTCTCTCCATCAACTCGAGTTGATGGAGAGAAGAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-4186s1c1
Sequence:CCGGGCTCTTTGAATGTATGTCAAACTCGAGTTTGACATACATTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-3049s1c1
Sequence:CCGGGCTGAGTTGAAATTCTACTAACTCGAGTTAGTAGAATTTCAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-794s1c1
Sequence:CCGGCCAGACAAGAATATAGTCTAACTCGAGTTAGACTATATTCTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-1891s1c1
Sequence:CCGGGCTGTTTGAATCAGGAATAATCTCGAGATTATTCCTGATTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205857
WDFY3-AS2 MISSION shRNA shRNA Plasmid DNA
WDFY3 antisense RNA 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-250s1c1
Sequence:CCGGGTGGCCATCTTTAATCCTCCTCTCGAGAGGAGGATTAAAGATGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-254s1c1
Sequence:CCGGCCATCTTTAATCCTCCTCCTCCTCGAGGAGGAGGAGGATTAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-163s1c1
Sequence:CCGGCGGGTTTCTTCTCTCCATCAACTCGAGTTGATGGAGAGAAGAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-4186s1c1
Sequence:CCGGGCTCTTTGAATGTATGTCAAACTCGAGTTTGACATACATTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-3049s1c1
Sequence:CCGGGCTGAGTTGAAATTCTACTAACTCGAGTTAGTAGAATTTCAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-794s1c1
Sequence:CCGGCCAGACAAGAATATAGTCTAACTCGAGTTAGACTATATTCTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-1891s1c1
Sequence:CCGGGCTGTTTGAATCAGGAATAATCTCGAGATTATTCCTGATTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205857
WDFY3-AS2 MISSION shRNA Lentiviral Transduction Particles
WDFY3 antisense RNA 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-250s1c1
Sequence:CCGGGTGGCCATCTTTAATCCTCCTCTCGAGAGGAGGATTAAAGATGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-254s1c1
Sequence:CCGGCCATCTTTAATCCTCCTCCTCCTCGAGGAGGAGGAGGATTAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205857.1-163s1c1
Sequence:CCGGCGGGTTTCTTCTCTCCATCAACTCGAGTTGATGGAGAGAAGAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-4186s1c1
Sequence:CCGGGCTCTTTGAATGTATGTCAAACTCGAGTTTGACATACATTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-3049s1c1
Sequence:CCGGGCTGAGTTGAAATTCTACTAACTCGAGTTAGTAGAATTTCAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-794s1c1
Sequence:CCGGCCAGACAAGAATATAGTCTAACTCGAGTTAGACTATATTCTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205857.1-1891s1c1
Sequence:CCGGGCTGTTTGAATCAGGAATAATCTCGAGATTATTCCTGATTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks