EMAIL THIS PAGE TO A FRIEND

WDFY3

WD repeat and FYVE domain containing 3

Synonyms: ALFY ZFYVE25
Gene ID:
Human(23001) Summary: This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
Mouse(72145) WD repeat and FYVE domain containing 3
Rat(305164) WD repeat and FYVE domain containing 3
Zebrafish(568432) WD repeat and FYVE domain containing 3
Horse(100052494) WD repeat and FYVE domain containing 3
domestic cat(101081888) WD repeat and FYVE domain containing 3
dog(487841) WD repeat and FYVE domain containing 3
chicken(422613) WD repeat and FYVE domain containing 3
cow(537096) WD repeat and FYVE domain containing 3
sheep(101110676) WD repeat and FYVE domain containing 3
domestic guinea pig(100723266) WD repeat and FYVE domain containing 3
naked mole-rat(101702562) WD repeat and FYVE domain containing 3
306 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178583 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014991 Rosetta Predictions human pricing
NM_178583 Rosetta Predictions human pricing
NM_178585 Rosetta Predictions human pricing
XM_001060345 Rosetta Predictions rat pricing
XM_001060403 Rosetta Predictions rat pricing
XM_223196 Rosetta Predictions rat pricing
NM_172882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016395 predicted 10354
2 SASI_Hs01_00016396 predicted 11166
3 SASI_Hs01_00016399 predicted 11070
4 SASI_Hs02_00346757 predicted 11170
5 SASI_Hs01_00016400 predicted 10577
6 SASI_Hs01_00016401 predicted 10598
7 SASI_Hs01_00016402 predicted 10529
8 SASI_Hs01_00016403 predicted 11213
9 SASI_Hs01_00016404 predicted 10370
10 SASI_Hs02_00346758 predicted 11085
11 SASI_Hs01_00016397 predicted 10583
12 SASI_Hs01_00016398 predicted 11172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058332 predicted 1065
2 SASI_Hs01_00058333 predicted 1721
3 SASI_Hs01_00058335 predicted 1506
4 SASI_Hs02_00369835 predicted 2165
5 SASI_Hs02_00369836 predicted 875
6 SASI_Hs01_00058336 predicted 445
7 SASI_Hs01_00058337 predicted 1555
8 SASI_Hs01_00058338 predicted 899
9 SASI_Hs01_00058339 predicted 1042
10 SASI_Hs02_00369837 predicted 769
11 SASI_Hs01_00058331 predicted 647
12 SASI_Hs01_00058334 predicted 840
13 SASI_Hs01_00058340 predicted 2155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233981 predicted 692
2 SASI_Hs01_00233982 predicted 1496
3 SASI_Hs01_00233985 predicted 1405
4 SASI_Hs02_00369839 predicted 1509
5 SASI_Hs01_00233986 predicted 915
6 SASI_Hs01_00233987 predicted 930
7 SASI_Hs01_00233988 predicted 864
8 SASI_Hs01_00233989 predicted 1549
9 SASI_Hs01_00233990 predicted 707
10 SASI_Hs02_00369840 predicted 1420
11 SASI_Hs01_00233983 predicted 916
12 SASI_Hs01_00233984 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296120 predicted 6854
2 SASI_Rn02_00296121 predicted 1587
3 SASI_Rn02_00296122 predicted 1245
4 SASI_Rn02_00296123 predicted 6354
5 SASI_Rn02_00296124 predicted 8304
6 SASI_Rn02_00296125 predicted 4598
7 SASI_Rn02_00296126 predicted 910
8 SASI_Rn02_00296127 predicted 3252
9 SASI_Rn02_00296128 predicted 3413
10 SASI_Rn02_00296129 predicted 8097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296394 predicted 6852
2 SASI_Rn02_00296395 predicted 1586
3 SASI_Rn02_00296396 predicted 1245
4 SASI_Rn02_00296397 predicted 6362
5 SASI_Rn02_00296398 predicted 8364
6 SASI_Rn02_00296399 predicted 4593
7 SASI_Rn02_00296400 predicted 912
8 SASI_Rn02_00296401 predicted 3252
9 SASI_Rn02_00296402 predicted 3413
10 SASI_Rn02_00296403 predicted 8151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381188 predicted 6975
2 SASI_Rn02_00381189 predicted 1709
3 SASI_Rn02_00381190 predicted 1365
4 SASI_Rn02_00381191 predicted 6478
5 SASI_Rn02_00381192 predicted 8488
6 SASI_Rn02_00381193 predicted 4718
7 SASI_Rn02_00381194 predicted 1037
8 SASI_Rn02_00381195 predicted 3378
9 SASI_Rn02_00381196 predicted 3540
10 SASI_Rn02_00381197 predicted 8281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127792 predicted 5710
2 SASI_Mm01_00127793 predicted 8322
3 SASI_Mm01_00127796 predicted 10605
4 SASI_Mm01_00127797 predicted 1452
5 SASI_Mm01_00127798 predicted 2130
6 SASI_Mm01_00127800 predicted 3095
7 SASI_Mm01_00127801 predicted 8901
8 SASI_Mm02_00344853 predicted 10515
9 SASI_Mm02_00344854 predicted 10678
10 SASI_Mm02_00344855 predicted 5535
11 SASI_Mm01_00127794 predicted 5403
12 SASI_Mm01_00127795 predicted 8878
13 SASI_Mm01_00127799 predicted 5637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172882
VALIDATED
WDFY3 MISSION shRNA Bacterial Glycerol Stock
WD repeat and FYVE domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-10613s21c2
Sequence:CCGGGCGCAGTTACAGCAGATTGAACTCGAGTTCAATCTGCTGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-6975s21c1
Sequence:CCGGCTCGCTCACTGCCTGATTAATCTCGAGATTAATCAGGCAGTGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-4376s21c1
Sequence:CCGGTTCTAGCGTGACTACTATTTACTCGAGTAAATAGTAGTCACGCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172882.2-11371s21c1
Sequence:CCGGTAGAGCTATTCATCCTTATTTCTCGAGAAATAAGGATGAATAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-1778s21c1
Sequence:CCGGTATGGCCGACAACGCTAATTACTCGAGTAATTAGCGTTGTCGGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-11186s1c1
Sequence:CCGGGCTGAGTGTAAAGGAATCATTCTCGAGAATGATTCCTTTACACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-4748s1c1
Sequence:CCGGCGCCACTACTTTACAGTACATCTCGAGATGTACTGTAAAGTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172882.2-2269s1c1
Sequence:CCGGGCGCCCACAATATAGTGAAATCTCGAGATTTCACTATATTGTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-5154s1c1
Sequence:CCGGGCCAAGTTGATGAGGGAATTTCTCGAGAAATTCCCTCATCAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-10613s1c1
Sequence:CCGGGCGCAGTTACAGCAGATTGAACTCGAGTTCAATCTGCTGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172882
VALIDATED
WDFY3 MISSION shRNA shRNA Plasmid DNA
WD repeat and FYVE domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-10613s21c2
Sequence:CCGGGCGCAGTTACAGCAGATTGAACTCGAGTTCAATCTGCTGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-6975s21c1
Sequence:CCGGCTCGCTCACTGCCTGATTAATCTCGAGATTAATCAGGCAGTGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-4376s21c1
Sequence:CCGGTTCTAGCGTGACTACTATTTACTCGAGTAAATAGTAGTCACGCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172882.2-11371s21c1
Sequence:CCGGTAGAGCTATTCATCCTTATTTCTCGAGAAATAAGGATGAATAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-1778s21c1
Sequence:CCGGTATGGCCGACAACGCTAATTACTCGAGTAATTAGCGTTGTCGGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-11186s1c1
Sequence:CCGGGCTGAGTGTAAAGGAATCATTCTCGAGAATGATTCCTTTACACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-4748s1c1
Sequence:CCGGCGCCACTACTTTACAGTACATCTCGAGATGTACTGTAAAGTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172882.2-2269s1c1
Sequence:CCGGGCGCCCACAATATAGTGAAATCTCGAGATTTCACTATATTGTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-5154s1c1
Sequence:CCGGGCCAAGTTGATGAGGGAATTTCTCGAGAAATTCCCTCATCAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-10613s1c1
Sequence:CCGGGCGCAGTTACAGCAGATTGAACTCGAGTTCAATCTGCTGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172882
VALIDATED
WDFY3 MISSION shRNA Lentiviral Transduction Particles
WD repeat and FYVE domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-10613s21c2
Sequence:CCGGGCGCAGTTACAGCAGATTGAACTCGAGTTCAATCTGCTGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-6975s21c1
Sequence:CCGGCTCGCTCACTGCCTGATTAATCTCGAGATTAATCAGGCAGTGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-4376s21c1
Sequence:CCGGTTCTAGCGTGACTACTATTTACTCGAGTAAATAGTAGTCACGCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172882.2-11371s21c1
Sequence:CCGGTAGAGCTATTCATCCTTATTTCTCGAGAAATAAGGATGAATAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172882.2-1778s21c1
Sequence:CCGGTATGGCCGACAACGCTAATTACTCGAGTAATTAGCGTTGTCGGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-11186s1c1
Sequence:CCGGGCTGAGTGTAAAGGAATCATTCTCGAGAATGATTCCTTTACACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-4748s1c1
Sequence:CCGGCGCCACTACTTTACAGTACATCTCGAGATGTACTGTAAAGTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172882.2-2269s1c1
Sequence:CCGGGCGCCCACAATATAGTGAAATCTCGAGATTTCACTATATTGTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-5154s1c1
Sequence:CCGGGCCAAGTTGATGAGGGAATTTCTCGAGAAATTCCCTCATCAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172882.2-10613s1c1
Sequence:CCGGGCGCAGTTACAGCAGATTGAACTCGAGTTCAATCTGCTGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178583
VALIDATED
WDFY3 MISSION shRNA Bacterial Glycerol Stock
WD repeat and FYVE domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-1045s21c1
Sequence:CCGGCGGATATGGCAAGGATATAATCTCGAGATTATATCCTTGCCATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-504s21c1
Sequence:CCGGGATGCTTCTAACGACAATTAACTCGAGTTAATTGTCGTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178583.1-2665s21c1
Sequence:CCGGATGGAAGCCTGTGTACTATTTCTCGAGAAATAGTACACAGGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-1696s21c1
Sequence:CCGGGATCCAACTCAGGCACTAAATCTCGAGATTTAGTGCCTGAGTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178583.1-796s21c1
Sequence:CCGGTCTTGGTGCCCTCCCTATAACCTCGAGGTTATAGGGAGGGCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-2045s1c1
Sequence:CCGGGCCATCGTTCAAGAACAGTTTCTCGAGAAACTGTTCTTGAACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-2495s1c1
Sequence:CCGGCCTCTGAATTAAAGGGTGTATCTCGAGATACACCCTTTAATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-584s1c1
Sequence:CCGGCCACCCTGGTTAAATGTTTATCTCGAGATAAACATTTAACCAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178583
VALIDATED
WDFY3 MISSION shRNA shRNA Plasmid DNA
WD repeat and FYVE domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-1045s21c1
Sequence:CCGGCGGATATGGCAAGGATATAATCTCGAGATTATATCCTTGCCATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-504s21c1
Sequence:CCGGGATGCTTCTAACGACAATTAACTCGAGTTAATTGTCGTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178583.1-2665s21c1
Sequence:CCGGATGGAAGCCTGTGTACTATTTCTCGAGAAATAGTACACAGGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-1696s21c1
Sequence:CCGGGATCCAACTCAGGCACTAAATCTCGAGATTTAGTGCCTGAGTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178583.1-796s21c1
Sequence:CCGGTCTTGGTGCCCTCCCTATAACCTCGAGGTTATAGGGAGGGCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-2045s1c1
Sequence:CCGGGCCATCGTTCAAGAACAGTTTCTCGAGAAACTGTTCTTGAACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-2495s1c1
Sequence:CCGGCCTCTGAATTAAAGGGTGTATCTCGAGATACACCCTTTAATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-584s1c1
Sequence:CCGGCCACCCTGGTTAAATGTTTATCTCGAGATAAACATTTAACCAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178583
VALIDATED
WDFY3 MISSION shRNA Lentiviral Transduction Particles
WD repeat and FYVE domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-1045s21c1
Sequence:CCGGCGGATATGGCAAGGATATAATCTCGAGATTATATCCTTGCCATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-504s21c1
Sequence:CCGGGATGCTTCTAACGACAATTAACTCGAGTTAATTGTCGTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178583.1-2665s21c1
Sequence:CCGGATGGAAGCCTGTGTACTATTTCTCGAGAAATAGTACACAGGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_178583.1-1696s21c1
Sequence:CCGGGATCCAACTCAGGCACTAAATCTCGAGATTTAGTGCCTGAGTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178583.1-796s21c1
Sequence:CCGGTCTTGGTGCCCTCCCTATAACCTCGAGGTTATAGGGAGGGCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-2045s1c1
Sequence:CCGGGCCATCGTTCAAGAACAGTTTCTCGAGAAACTGTTCTTGAACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-2495s1c1
Sequence:CCGGCCTCTGAATTAAAGGGTGTATCTCGAGATACACCCTTTAATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178583.1-584s1c1
Sequence:CCGGCCACCCTGGTTAAATGTTTATCTCGAGATAAACATTTAACCAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks