EMAIL THIS PAGE TO A FRIEND

WDFY4

WDFY family member 4

Synonyms: C10orf64
Gene ID:
Mouse(545030) WD repeat and FYVE domain containing 4
Zebrafish(572477) WDFY family member 4
domestic cat(101095285) WDFY family member 4
dog(486770) WDFY family member 4
chicken(423781) WDFY family member 4
naked mole-rat(101714542) WDFY family member 4
Domestic Rabbit(100347362) WDFY family member 4
domestic guinea pig(100720600) WDFY family member 4
cow(527790) WDFY family member 4
sheep(101117047) WDFY family member 4
8 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040634 Anti-WDFY4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001146022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001146022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020945 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094881 MISSION® esiRNA esiRNA human C10orf64 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146022
WDFY4 MISSION shRNA Bacterial Glycerol Stock
WDFY family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-3693s21c1
Sequence:CCGGGTGGATGTTTATGGCTATATTCTCGAGAATATAGCCATAAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-1172s21c1
Sequence:CCGGCAAGGTACTGCTGCGGTATAACTCGAGTTATACCGCAGCAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-7990s21c1
Sequence:CCGGACCACTGGATAGACCTAATTTCTCGAGAAATTAGGTCTATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146022.1-9447s21c1
Sequence:CCGGTTTGCACCGTGTACCCTAAACCTCGAGGTTTAGGGTACACGGTGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-7224s21c1
Sequence:CCGGTATAACAGCGACCGGAGTAAACTCGAGTTTACTCCGGTCGCTGTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146022
WDFY4 MISSION shRNA shRNA Plasmid DNA
WDFY family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-3693s21c1
Sequence:CCGGGTGGATGTTTATGGCTATATTCTCGAGAATATAGCCATAAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-1172s21c1
Sequence:CCGGCAAGGTACTGCTGCGGTATAACTCGAGTTATACCGCAGCAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-7990s21c1
Sequence:CCGGACCACTGGATAGACCTAATTTCTCGAGAAATTAGGTCTATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146022.1-9447s21c1
Sequence:CCGGTTTGCACCGTGTACCCTAAACCTCGAGGTTTAGGGTACACGGTGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-7224s21c1
Sequence:CCGGTATAACAGCGACCGGAGTAAACTCGAGTTTACTCCGGTCGCTGTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146022
WDFY4 MISSION shRNA Lentiviral Transduction Particles
WDFY family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-3693s21c1
Sequence:CCGGGTGGATGTTTATGGCTATATTCTCGAGAATATAGCCATAAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-1172s21c1
Sequence:CCGGCAAGGTACTGCTGCGGTATAACTCGAGTTATACCGCAGCAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-7990s21c1
Sequence:CCGGACCACTGGATAGACCTAATTTCTCGAGAAATTAGGTCTATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146022.1-9447s21c1
Sequence:CCGGTTTGCACCGTGTACCCTAAACCTCGAGGTTTAGGGTACACGGTGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146022.1-7224s21c1
Sequence:CCGGTATAACAGCGACCGGAGTAAACTCGAGTTTACTCCGGTCGCTGTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020945
WDFY4 MISSION shRNA Bacterial Glycerol Stock
WDFY family member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-7197s21c1
Sequence:CCGGTGTCGGGAAAGACAAGTTATTCTCGAGAATAACTTGTCTTTCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-3710s21c1
Sequence:CCGGTGTGGATGTTTATGGATATATCTCGAGATATATCCATAAACATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-4122s21c1
Sequence:CCGGGCTGTTGCTGTGGGTCAATTACTCGAGTAATTGACCCACAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-8335s21c1
Sequence:CCGGACCATTGGATAGACCTTATTTCTCGAGAAATAAGGTCTATCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020945.1-9798s21c1
Sequence:CCGGATGGCCGATGGGACTTCTATGCTCGAGCATAGAAGTCCCATCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020945
WDFY4 MISSION shRNA shRNA Plasmid DNA
WDFY family member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-7197s21c1
Sequence:CCGGTGTCGGGAAAGACAAGTTATTCTCGAGAATAACTTGTCTTTCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-3710s21c1
Sequence:CCGGTGTGGATGTTTATGGATATATCTCGAGATATATCCATAAACATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-4122s21c1
Sequence:CCGGGCTGTTGCTGTGGGTCAATTACTCGAGTAATTGACCCACAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-8335s21c1
Sequence:CCGGACCATTGGATAGACCTTATTTCTCGAGAAATAAGGTCTATCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020945.1-9798s21c1
Sequence:CCGGATGGCCGATGGGACTTCTATGCTCGAGCATAGAAGTCCCATCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020945
WDFY4 MISSION shRNA Lentiviral Transduction Particles
WDFY family member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-7197s21c1
Sequence:CCGGTGTCGGGAAAGACAAGTTATTCTCGAGAATAACTTGTCTTTCCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-3710s21c1
Sequence:CCGGTGTGGATGTTTATGGATATATCTCGAGATATATCCATAAACATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-4122s21c1
Sequence:CCGGGCTGTTGCTGTGGGTCAATTACTCGAGTAATTGACCCACAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020945.1-8335s21c1
Sequence:CCGGACCATTGGATAGACCTTATTTCTCGAGAAATAAGGTCTATCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020945.1-9798s21c1
Sequence:CCGGATGGCCGATGGGACTTCTATGCTCGAGCATAGAAGTCCCATCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks