EMAIL THIS PAGE TO A FRIEND

WDHD1

WD repeat and HMG-box DNA binding protein 1

Synonyms: AND-1 CHTF4 CTF4
UniProtKB ID: O75717
Gene ID:
Human(11169) Summary: The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(218973) WD repeat and HMG-box DNA binding protein 1
Rat(305827) WD repeat and HMG-box DNA binding protein 1
cow(540681) WD repeat and HMG-box DNA binding protein 1
sheep(101117672) WD repeat and HMG-box DNA binding protein 1
domestic guinea pig(100735472) WD repeat and HMG-box DNA binding protein 1
Domestic Rabbit(100356999) WD repeat and HMG-box DNA binding protein 1
naked mole-rat(101705065) WD repeat and HMG-box DNA binding protein 1
Zebrafish(436999) WD repeat and HMG-box DNA binding protein 1
Horse(100050233) WD repeat and HMG-box DNA binding protein 1
domestic cat(101080717) WD repeat and HMG-box DNA binding protein 1
dog(490701) WD repeat and HMG-box DNA binding protein 1
chicken(423558) WD repeat and HMG-box DNA binding protein 1
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007086 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008396 Rosetta Predictions human pricing
NM_007086 Rosetta Predictions human pricing
NM_001107255 Rosetta Predictions rat pricing
NM_172598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031568 predicted 1541
2 SASI_Hs01_00031569 predicted 862
3 SASI_Hs01_00031570 predicted 1941
4 SASI_Hs01_00031571 predicted 2784
5 SASI_Hs01_00031572 predicted 731
6 SASI_Hs01_00031573 predicted 1835
7 SASI_Hs01_00031574 predicted 1208
8 SASI_Hs01_00031576 predicted 2757
9 SASI_Hs01_00031577 predicted 820
10 SASI_Hs02_00305435 predicted 3100
11 SASI_Hs01_00031575 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022024 predicted 1634
2 SASI_Hs01_00022025 predicted 961
3 SASI_Hs01_00022026 predicted 2040
4 SASI_Hs01_00022027 predicted 2884
5 SASI_Hs01_00022028 predicted 824
6 SASI_Hs01_00022029 predicted 1932
7 SASI_Hs01_00022030 predicted 1299
8 SASI_Hs01_00022032 predicted 2853
9 SASI_Hs01_00022033 predicted 920
10 SASI_Hs02_00342926 predicted 3193
11 SASI_Hs01_00022031 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227035 predicted 1761
2 SASI_Rn02_00227036 predicted 947
3 SASI_Rn02_00227037 predicted 2434
4 SASI_Rn02_00227038 predicted 2051
5 SASI_Rn02_00227039 predicted 3330
6 SASI_Rn02_00227040 predicted 476
7 SASI_Rn02_00227041 predicted 1719
8 SASI_Rn02_00227042 predicted 3632
9 SASI_Rn02_00227043 predicted 1936
10 SASI_Rn02_00227044 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142891 predicted 1432
2 SASI_Mm01_00142892 predicted 1256
3 SASI_Mm02_00344296 predicted 480
4 SASI_Mm01_00142893 predicted 1425
5 SASI_Mm01_00142894 predicted 2293
6 SASI_Mm01_00142895 predicted 449
7 SASI_Mm01_00142896 predicted 2724
8 SASI_Mm01_00142897 predicted 1621
9 SASI_Mm01_00142898 predicted 3337
10 SASI_Mm02_00344297 predicted 3403
11 SASI_Mm01_00142889 predicted 1978
12 SASI_Mm01_00142890 predicted 3202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007086
WDHD1 MISSION shRNA Bacterial Glycerol Stock
WD repeat and HMG-box DNA binding protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2476s21c1
Sequence:CCGGGCTTCTCGCTCTCGGAAATTACTCGAGTAATTTCCGAGAGCGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2793s21c1
Sequence:CCGGTAGCAGCCAAGGACGAGTAAACTCGAGTTTACTCGTCCTTGGCTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2862s21c1
Sequence:CCGGTTCAGCACGTTCAACTAATATCTCGAGATATTAGTTGAACGTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007086.1-3490s1c1
Sequence:CCGGCGAGTCTTTGGGAAACTCATTCTCGAGAATGAGTTTCCCAAAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-882s1c1
Sequence:CCGGGCATCCTACTTGTGGTCGAATCTCGAGATTCGACCACAAGTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-1627s1c1
Sequence:CCGGCCTCAGAATGAGGATATTGAACTCGAGTTCAATATCCTCATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-2914s1c1
Sequence:CCGGCCCATTATAAAGCCTCTGATTCTCGAGAATCAGAGGCTTTATAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-1691s1c1
Sequence:CCGGCCCTGCTTCTTCGATTGTTTACTCGAGTAAACAATCGAAGAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007086
WDHD1 MISSION shRNA shRNA Plasmid DNA
WD repeat and HMG-box DNA binding protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2476s21c1
Sequence:CCGGGCTTCTCGCTCTCGGAAATTACTCGAGTAATTTCCGAGAGCGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2793s21c1
Sequence:CCGGTAGCAGCCAAGGACGAGTAAACTCGAGTTTACTCGTCCTTGGCTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2862s21c1
Sequence:CCGGTTCAGCACGTTCAACTAATATCTCGAGATATTAGTTGAACGTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007086.1-3490s1c1
Sequence:CCGGCGAGTCTTTGGGAAACTCATTCTCGAGAATGAGTTTCCCAAAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-882s1c1
Sequence:CCGGGCATCCTACTTGTGGTCGAATCTCGAGATTCGACCACAAGTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-1627s1c1
Sequence:CCGGCCTCAGAATGAGGATATTGAACTCGAGTTCAATATCCTCATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-2914s1c1
Sequence:CCGGCCCATTATAAAGCCTCTGATTCTCGAGAATCAGAGGCTTTATAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-1691s1c1
Sequence:CCGGCCCTGCTTCTTCGATTGTTTACTCGAGTAAACAATCGAAGAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007086
WDHD1 MISSION shRNA Lentiviral Transduction Particles
WD repeat and HMG-box DNA binding protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2476s21c1
Sequence:CCGGGCTTCTCGCTCTCGGAAATTACTCGAGTAATTTCCGAGAGCGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2793s21c1
Sequence:CCGGTAGCAGCCAAGGACGAGTAAACTCGAGTTTACTCGTCCTTGGCTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007086.2-2862s21c1
Sequence:CCGGTTCAGCACGTTCAACTAATATCTCGAGATATTAGTTGAACGTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007086.1-3490s1c1
Sequence:CCGGCGAGTCTTTGGGAAACTCATTCTCGAGAATGAGTTTCCCAAAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-882s1c1
Sequence:CCGGGCATCCTACTTGTGGTCGAATCTCGAGATTCGACCACAAGTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-1627s1c1
Sequence:CCGGCCTCAGAATGAGGATATTGAACTCGAGTTCAATATCCTCATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-2914s1c1
Sequence:CCGGCCCATTATAAAGCCTCTGATTCTCGAGAATCAGAGGCTTTATAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007086.1-1691s1c1
Sequence:CCGGCCCTGCTTCTTCGATTGTTTACTCGAGTAAACAATCGAAGAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172598
VALIDATED
WDHD1 MISSION shRNA Bacterial Glycerol Stock
WD repeat and HMG-box DNA binding protein 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-1629s21c1
Sequence:CCGGTGTGAAAGTGCTGATGAATTACTCGAGTAATTCATCAGCACTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-974s21c1
Sequence:CCGGGTCTCCCTGTGGGCAGTATTTCTCGAGAAATACTGCCCACAGGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-3925s21c1
Sequence:CCGGGGGCTTTCCCGCCTTTGTTTACTCGAGTAAACAAAGGCGGGAAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-1786s21c1
Sequence:CCGGTCCTTCGACTGTTCACTATTGCTCGAGCAATAGTGAACAGTCGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-2405s21c1
Sequence:CCGGAGAGCAGCAGGAACTCTTAATCTCGAGATTAAGAGTTCCTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-2369s21c1
Sequence:CCGGTGATTATGAGGAGAGCATTAACTCGAGTTAATGCTCTCCTCATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-1194s21c1
Sequence:CCGGAGCAATAAGGGCATTATAAATCTCGAGATTTATAATGCCCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172598.2-3909s1c1
Sequence:CCGGGCTTCCCAAGTGAGATGTCATCTCGAGATGACATCTCACTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2436s1c1
Sequence:CCGGCCGTGCATTTAGCCATTAAATCTCGAGATTTAATGGCTAAATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-1427s1c1
Sequence:CCGGCGCTGCTATAACGACGATCAACTCGAGTTGATCGTCGTTATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2730s1c1
Sequence:CCGGCCTCTGATACACCAGCTCTTACTCGAGTAAGAGCTGGTGTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2435s1c1
Sequence:CCGGGCCGTGCATTTAGCCATTAAACTCGAGTTTAATGGCTAAATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172598
VALIDATED
WDHD1 MISSION shRNA shRNA Plasmid DNA
WD repeat and HMG-box DNA binding protein 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-1629s21c1
Sequence:CCGGTGTGAAAGTGCTGATGAATTACTCGAGTAATTCATCAGCACTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-974s21c1
Sequence:CCGGGTCTCCCTGTGGGCAGTATTTCTCGAGAAATACTGCCCACAGGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-3925s21c1
Sequence:CCGGGGGCTTTCCCGCCTTTGTTTACTCGAGTAAACAAAGGCGGGAAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-1786s21c1
Sequence:CCGGTCCTTCGACTGTTCACTATTGCTCGAGCAATAGTGAACAGTCGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-2405s21c1
Sequence:CCGGAGAGCAGCAGGAACTCTTAATCTCGAGATTAAGAGTTCCTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-2369s21c1
Sequence:CCGGTGATTATGAGGAGAGCATTAACTCGAGTTAATGCTCTCCTCATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-1194s21c1
Sequence:CCGGAGCAATAAGGGCATTATAAATCTCGAGATTTATAATGCCCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172598.2-3909s1c1
Sequence:CCGGGCTTCCCAAGTGAGATGTCATCTCGAGATGACATCTCACTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2436s1c1
Sequence:CCGGCCGTGCATTTAGCCATTAAATCTCGAGATTTAATGGCTAAATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-1427s1c1
Sequence:CCGGCGCTGCTATAACGACGATCAACTCGAGTTGATCGTCGTTATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2730s1c1
Sequence:CCGGCCTCTGATACACCAGCTCTTACTCGAGTAAGAGCTGGTGTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2435s1c1
Sequence:CCGGGCCGTGCATTTAGCCATTAAACTCGAGTTTAATGGCTAAATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172598
VALIDATED
WDHD1 MISSION shRNA Lentiviral Transduction Particles
WD repeat and HMG-box DNA binding protein 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-1629s21c1
Sequence:CCGGTGTGAAAGTGCTGATGAATTACTCGAGTAATTCATCAGCACTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-974s21c1
Sequence:CCGGGTCTCCCTGTGGGCAGTATTTCTCGAGAAATACTGCCCACAGGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-3925s21c1
Sequence:CCGGGGGCTTTCCCGCCTTTGTTTACTCGAGTAAACAAAGGCGGGAAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-1786s21c1
Sequence:CCGGTCCTTCGACTGTTCACTATTGCTCGAGCAATAGTGAACAGTCGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172598.3-2405s21c1
Sequence:CCGGAGAGCAGCAGGAACTCTTAATCTCGAGATTAAGAGTTCCTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-2369s21c1
Sequence:CCGGTGATTATGAGGAGAGCATTAACTCGAGTTAATGCTCTCCTCATAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172598.3-1194s21c1
Sequence:CCGGAGCAATAAGGGCATTATAAATCTCGAGATTTATAATGCCCTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172598.2-3909s1c1
Sequence:CCGGGCTTCCCAAGTGAGATGTCATCTCGAGATGACATCTCACTTGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2436s1c1
Sequence:CCGGCCGTGCATTTAGCCATTAAATCTCGAGATTTAATGGCTAAATGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-1427s1c1
Sequence:CCGGCGCTGCTATAACGACGATCAACTCGAGTTGATCGTCGTTATAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2730s1c1
Sequence:CCGGCCTCTGATACACCAGCTCTTACTCGAGTAAGAGCTGGTGTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172598.2-2435s1c1
Sequence:CCGGGCCGTGCATTTAGCCATTAAACTCGAGTTTAATGGCTAAATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks