EMAIL THIS PAGE TO A FRIEND

WDPCP

WD repeat containing planar cell polarity effector

Synonyms: BBS15 C2orf86 FRITZ FRTZ
UniProtKB ID: O95876, Q53RW4, Q7Z2Z3
Gene ID:
Human(51057) Summary: This gene encodes a cytoplasmic WD40 repeat protein. A similar gene in frogs encodes a planar cell polarity protein that plays a critical role in collective cell movement and ciliogenesis by mediating septin localization. Mutations in this gene are associated with Bardet-Biedl syndrome 15 and may also play a role in Meckel-Gruber syndrome. [provided by RefSeq, Feb 2011]
Mouse(216560) WD repeat containing planar cell polarity effector
Rat(305552) WD repeat containing planar cell polarity effector
chicken(428553) WD repeat containing planar cell polarity effector
domestic cat(101085794) WD repeat containing planar cell polarity effector
dog(474613) WD repeat containing planar cell polarity effector
naked mole-rat(101702653) WD repeat containing planar cell polarity effector
cow(527992) WD repeat containing planar cell polarity effector
sheep(101119202) WD repeat containing planar cell polarity effector
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042692 Rosetta Predictions human pricing
NM_015910 Rosetta Predictions human pricing
NM_001127537 Rosetta Predictions rat pricing
NM_145425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310995 predicted 816
2 SASI_Hs02_00310996 predicted 1469
3 SASI_Hs02_00310997 predicted 477
4 SASI_Hs02_00310998 predicted 1401
5 SASI_Hs02_00310999 predicted 1541
6 SASI_Hs02_00311000 predicted 1533
7 SASI_Hs02_00311001 predicted 640
8 SASI_Hs02_00311002 predicted 587
9 SASI_Hs02_00311003 predicted 1815
10 SASI_Hs02_00311004 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022234 predicted 1669
2 SASI_Hs02_00348510 predicted 2329
3 SASI_Hs01_00022235 predicted 1326
4 SASI_Hs02_00348511 predicted 2260
5 SASI_Hs02_00348512 predicted 2396
6 SASI_Hs02_00348513 predicted 2378
7 SASI_Hs01_00022240 predicted 1488
8 SASI_Hs01_00022241 predicted 1447
9 SASI_Hs02_00348514 predicted 2662
10 SASI_Hs02_00348515 predicted 2588
11 SASI_Hs01_00022232 predicted 899
12 SASI_Hs01_00022233 predicted 465
13 SASI_Hs01_00022236 predicted 649
14 SASI_Hs01_00022237 predicted 1202
15 SASI_Hs01_00022238 predicted 359
16 SASI_Hs01_00022239 predicted 1613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254123 predicted 2065
2 SASI_Rn02_00254124 predicted 1152
3 SASI_Rn02_00254125 predicted 1655
4 SASI_Rn02_00254126 predicted 1075
5 SASI_Rn02_00254127 predicted 1462
6 SASI_Rn02_00254128 predicted 1211
7 SASI_Rn02_00254129 predicted 1858
8 SASI_Rn02_00254130 predicted 1538
9 SASI_Rn02_00254131 predicted 756
10 SASI_Rn02_00254132 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140199 predicted 1149
2 SASI_Mm01_00140200 predicted 1426
3 SASI_Mm02_00340776 predicted 1828
4 SASI_Mm01_00140201 predicted 1821
5 SASI_Mm01_00140202 predicted 905
6 SASI_Mm01_00140204 predicted 456
7 SASI_Mm01_00140205 predicted 1661
8 SASI_Mm01_00140206 predicted 517
9 SASI_Mm01_00140207 predicted 1003
10 SASI_Mm02_00340777 predicted 1731
11 SASI_Mm01_00140203 predicted 545
12 SASI_Mm01_00140208 predicted 1248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145425
WDPCP MISSION shRNA Bacterial Glycerol Stock
WD repeat containing planar cell polarity effector
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000196157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-2028s1c1
Sequence:CCGGGCCTTCTTCCTTCCATTGGTTCTCGAGAACCAATGGAAGGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-159s1c1
Sequence:CCGGGCACCTTACACATTGCGGATACTCGAGTATCCGCAATGTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-265s1c1
Sequence:CCGGGCTGGCAGAATCACGAGATTACTCGAGTAATCTCGTGATTCTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-270s1c1
Sequence:CCGGCAGAATCACGAGATTATCCTTCTCGAGAAGGATAATCTCGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145425
WDPCP MISSION shRNA shRNA Plasmid DNA
WD repeat containing planar cell polarity effector
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000196157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-2028s1c1
Sequence:CCGGGCCTTCTTCCTTCCATTGGTTCTCGAGAACCAATGGAAGGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-159s1c1
Sequence:CCGGGCACCTTACACATTGCGGATACTCGAGTATCCGCAATGTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-265s1c1
Sequence:CCGGGCTGGCAGAATCACGAGATTACTCGAGTAATCTCGTGATTCTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-270s1c1
Sequence:CCGGCAGAATCACGAGATTATCCTTCTCGAGAAGGATAATCTCGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145425
WDPCP MISSION shRNA Lentiviral Transduction Particles
WD repeat containing planar cell polarity effector
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000196157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-2028s1c1
Sequence:CCGGGCCTTCTTCCTTCCATTGGTTCTCGAGAACCAATGGAAGGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-159s1c1
Sequence:CCGGGCACCTTACACATTGCGGATACTCGAGTATCCGCAATGTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-265s1c1
Sequence:CCGGGCTGGCAGAATCACGAGATTACTCGAGTAATCTCGTGATTCTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145425.2-270s1c1
Sequence:CCGGCAGAATCACGAGATTATCCTTCTCGAGAAGGATAATCTCGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015910
VALIDATED
WDPCP MISSION shRNA Bacterial Glycerol Stock
WD repeat containing planar cell polarity effector
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015910.2-711s1c1
Sequence:CCGGGCTGTGAAGATTCTTCGCTAACTCGAGTTAGCGAAGAATCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1224s1c1
Sequence:CCGGCCATTGTAAACCATCTTCTTACTCGAGTAAGAAGATGGTTTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-223s1c1
Sequence:CCGGGATGGAGTCTTCTGATGTAAACTCGAGTTTACATCAGAAGACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1713s1c1
Sequence:CCGGGCTCTTCTAACAGACAAATAACTCGAGTTATTTGTCTGTTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1460s1c1
Sequence:CCGGGATATTCATTACCTTGCACTACTCGAGTAGTGCAAGGTAATGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1933s21c1
Sequence:CCGGTTCACTGTGATGAGATCTATGCTCGAGCATAGATCTCATCACAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1775s21c1
Sequence:CCGGGATAGCTCCTCAGGTTGTTTCCTCGAGGAAACAACCTGAGGAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-2136s21c1
Sequence:CCGGTTGGAATATAGAGATCAAATCCTCGAGGATTTGATCTCTATATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1401s21c1
Sequence:CCGGTATGAATGCATTCGGAATAAACTCGAGTTTATTCCGAATGCATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1718s21c1
Sequence:CCGGGACTCTGCAATTCAGTAAATTCTCGAGAATTTACTGAATTGCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1059s21c1
Sequence:CCGGCTCTCAGCCTTGGATTATAAGCTCGAGCTTATAATCCAAGGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015910.4-2874s21c1
Sequence:CCGGAGCAAAGTGATCGTAAGTAAACTCGAGTTTACTTACGATCACTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015910
VALIDATED
WDPCP MISSION shRNA shRNA Plasmid DNA
WD repeat containing planar cell polarity effector
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015910.2-711s1c1
Sequence:CCGGGCTGTGAAGATTCTTCGCTAACTCGAGTTAGCGAAGAATCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1224s1c1
Sequence:CCGGCCATTGTAAACCATCTTCTTACTCGAGTAAGAAGATGGTTTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-223s1c1
Sequence:CCGGGATGGAGTCTTCTGATGTAAACTCGAGTTTACATCAGAAGACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1713s1c1
Sequence:CCGGGCTCTTCTAACAGACAAATAACTCGAGTTATTTGTCTGTTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1460s1c1
Sequence:CCGGGATATTCATTACCTTGCACTACTCGAGTAGTGCAAGGTAATGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1933s21c1
Sequence:CCGGTTCACTGTGATGAGATCTATGCTCGAGCATAGATCTCATCACAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1775s21c1
Sequence:CCGGGATAGCTCCTCAGGTTGTTTCCTCGAGGAAACAACCTGAGGAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-2136s21c1
Sequence:CCGGTTGGAATATAGAGATCAAATCCTCGAGGATTTGATCTCTATATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1401s21c1
Sequence:CCGGTATGAATGCATTCGGAATAAACTCGAGTTTATTCCGAATGCATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1718s21c1
Sequence:CCGGGACTCTGCAATTCAGTAAATTCTCGAGAATTTACTGAATTGCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1059s21c1
Sequence:CCGGCTCTCAGCCTTGGATTATAAGCTCGAGCTTATAATCCAAGGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015910.4-2874s21c1
Sequence:CCGGAGCAAAGTGATCGTAAGTAAACTCGAGTTTACTTACGATCACTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015910
VALIDATED
WDPCP MISSION shRNA Lentiviral Transduction Particles
WD repeat containing planar cell polarity effector
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015910.2-711s1c1
Sequence:CCGGGCTGTGAAGATTCTTCGCTAACTCGAGTTAGCGAAGAATCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1224s1c1
Sequence:CCGGCCATTGTAAACCATCTTCTTACTCGAGTAAGAAGATGGTTTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-223s1c1
Sequence:CCGGGATGGAGTCTTCTGATGTAAACTCGAGTTTACATCAGAAGACTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1713s1c1
Sequence:CCGGGCTCTTCTAACAGACAAATAACTCGAGTTATTTGTCTGTTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015910.2-1460s1c1
Sequence:CCGGGATATTCATTACCTTGCACTACTCGAGTAGTGCAAGGTAATGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1933s21c1
Sequence:CCGGTTCACTGTGATGAGATCTATGCTCGAGCATAGATCTCATCACAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1775s21c1
Sequence:CCGGGATAGCTCCTCAGGTTGTTTCCTCGAGGAAACAACCTGAGGAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-2136s21c1
Sequence:CCGGTTGGAATATAGAGATCAAATCCTCGAGGATTTGATCTCTATATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1401s21c1
Sequence:CCGGTATGAATGCATTCGGAATAAACTCGAGTTTATTCCGAATGCATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1718s21c1
Sequence:CCGGGACTCTGCAATTCAGTAAATTCTCGAGAATTTACTGAATTGCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015910.4-1059s21c1
Sequence:CCGGCTCTCAGCCTTGGATTATAAGCTCGAGCTTATAATCCAAGGCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015910.4-2874s21c1
Sequence:CCGGAGCAAAGTGATCGTAAGTAAACTCGAGTTTACTTACGATCACTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks