EMAIL THIS PAGE TO A FRIEND

WDR11

WD repeat domain 11

Synonyms: BRWD2 DR11 HH14 WDR15
UniProtKB ID: Q9BZH6, Q5VWA1, Q9P2J6
Gene ID:
Human(55717) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is located in the chromosome 10q25-26 region, which is frequently deleted in gliomas and tumors of other tissues, and is disrupted by the t(10;19) translocation rearrangement in glioblastoma cells. The gene location suggests that it is a candidate gene for the tumor suppressor locus. [provided by RefSeq, Jul 2008]
Mouse(207425) WD repeat domain 11
Rat(309016) WD repeat domain 11
naked mole-rat(101711960) WD repeat domain 11
domestic guinea pig(100717615) WD repeat domain 11
cow(525169) WD repeat domain 11
sheep(101109577) WD repeat domain 11
Zebrafish(558865) WD repeat domain 11
Horse(100065386) WD repeat domain 11
domestic cat(101094957) WD repeat domain 11
dog(477847) WD repeat domain 11
chicken(423935) WD repeat domain 11
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018117 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018117 Rosetta Predictions human pricing
XM_001080483 Rosetta Predictions rat pricing
XM_219377 Rosetta Predictions rat pricing
NM_172255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351324 predicted 3072
2 SASI_Hs02_00351325 predicted 2435
3 SASI_Hs01_00169085 predicted 471
4 SASI_Hs01_00169086 predicted 2116
5 SASI_Hs01_00169087 predicted 2462
6 SASI_Hs02_00351326 predicted 3896
7 SASI_Hs01_00169090 predicted 1777
8 SASI_Hs01_00169091 predicted 1969
9 SASI_Hs02_00351327 predicted 1841
10 SASI_Hs02_00351328 predicted 1928
11 SASI_Hs01_00169083 predicted 2180
12 SASI_Hs01_00169084 predicted 3681
13 SASI_Hs01_00169088 predicted 2029
14 SASI_Hs01_00169089 predicted 3797
15 SASI_Hs01_00169092 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368121 predicted 3157
2 SASI_Rn02_00368122 predicted 3544
3 SASI_Rn02_00368123 predicted 2462
4 SASI_Rn02_00368124 predicted 2183
5 SASI_Rn02_00368125 predicted 203
6 SASI_Rn02_00368126 predicted 3254
7 SASI_Rn02_00368127 predicted 2271
8 SASI_Rn02_00368128 predicted 2137
9 SASI_Rn02_00368129 predicted 2787
10 SASI_Rn02_00368130 predicted 3522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378454 predicted 3160
2 SASI_Rn02_00378455 predicted 3542
3 SASI_Rn02_00378456 predicted 2465
4 SASI_Rn02_00378457 predicted 2185
5 SASI_Rn02_00378458 predicted 200
6 SASI_Rn02_00378459 predicted 3257
7 SASI_Rn02_00378460 predicted 2270
8 SASI_Rn02_00378461 predicted 2144
9 SASI_Rn02_00378462 predicted 2789
10 SASI_Rn02_00378463 predicted 3526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119317 predicted 3492
2 SASI_Mm01_00119318 predicted 2134
3 SASI_Mm02_00343719 predicted 2967
4 SASI_Mm01_00119319 predicted 3197
5 SASI_Mm01_00119321 predicted 1744
6 SASI_Mm01_00119322 predicted 2334
7 SASI_Mm01_00119323 predicted 2420
8 SASI_Mm01_00119324 predicted 3600
9 SASI_Mm01_00119326 predicted 1871
10 SASI_Mm02_00343720 predicted 224
11 SASI_Mm01_00119320 predicted 2225
12 SASI_Mm01_00119325 predicted 1786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172255
VALIDATED
WDR11 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 11
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172255.1-2181s1c1
Sequence:CCGGGCAGTATTACCTGCATCGCTTCTCGAGAAGCGATGCAGGTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172255.1-4228s1c1
Sequence:CCGGGCTTTAGACATTGCTGAACTTCTCGAGAAGTTCAGCAATGTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172255.1-1304s1c1
Sequence:CCGGCAGAATAAACTCCCAGACCTTCTCGAGAAGGTCTGGGAGTTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172255.1-4213s1c1
Sequence:CCGGCGTGGTGGATTCTTTGCTTTACTCGAGTAAAGCAAAGAATCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172255
VALIDATED
WDR11 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 11
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172255.1-2181s1c1
Sequence:CCGGGCAGTATTACCTGCATCGCTTCTCGAGAAGCGATGCAGGTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172255.1-4228s1c1
Sequence:CCGGGCTTTAGACATTGCTGAACTTCTCGAGAAGTTCAGCAATGTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172255.1-1304s1c1
Sequence:CCGGCAGAATAAACTCCCAGACCTTCTCGAGAAGGTCTGGGAGTTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172255.1-4213s1c1
Sequence:CCGGCGTGGTGGATTCTTTGCTTTACTCGAGTAAAGCAAAGAATCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172255
VALIDATED
WDR11 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 11
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172255.1-2181s1c1
Sequence:CCGGGCAGTATTACCTGCATCGCTTCTCGAGAAGCGATGCAGGTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172255.1-4228s1c1
Sequence:CCGGGCTTTAGACATTGCTGAACTTCTCGAGAAGTTCAGCAATGTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172255.1-1304s1c1
Sequence:CCGGCAGAATAAACTCCCAGACCTTCTCGAGAAGGTCTGGGAGTTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172255.1-4213s1c1
Sequence:CCGGCGTGGTGGATTCTTTGCTTTACTCGAGTAAAGCAAAGAATCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018117
VALIDATED
WDR11 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018117.10-1988s1c1
Sequence:CCGGGCAGTCGTATTCAGAGATAAACTCGAGTTTATCTCTGAATACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018117.10-2386s1c1
Sequence:CCGGCGCTTGGAAAGGTGATACATTCTCGAGAATGTATCACCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018117.10-3916s1c1
Sequence:CCGGGCTTAATAAATGCCAGGGAATCTCGAGATTCCCTGGCATTTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018117.10-2595s1c1
Sequence:CCGGGCAGTTTAAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018117.10-622s1c1
Sequence:CCGGCCGCGATTTACTGCTTGCTATCTCGAGATAGCAAGCAGTAAATCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-2595s21c1
Sequence:CCGGGCAGTTTAAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-4116s21c1
Sequence:CCGGGAACGTGAATGCTTAAGATTTCTCGAGAAATCTTAAGCATTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-1988s21c1
Sequence:CCGGGCAGTCGTATTCAGAGATAAACTCGAGTTTATCTCTGAATACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018117.10-2386s21c1
Sequence:CCGGCGCTTGGAAAGGTGATACATTCTCGAGAATGTATCACCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018117.10-1180s21c1
Sequence:CCGGACGTGTTCGAAGATCTTATAACTCGAGTTATAAGATCTTCGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018117
VALIDATED
WDR11 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018117.10-1988s1c1
Sequence:CCGGGCAGTCGTATTCAGAGATAAACTCGAGTTTATCTCTGAATACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018117.10-2386s1c1
Sequence:CCGGCGCTTGGAAAGGTGATACATTCTCGAGAATGTATCACCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018117.10-3916s1c1
Sequence:CCGGGCTTAATAAATGCCAGGGAATCTCGAGATTCCCTGGCATTTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018117.10-2595s1c1
Sequence:CCGGGCAGTTTAAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018117.10-622s1c1
Sequence:CCGGCCGCGATTTACTGCTTGCTATCTCGAGATAGCAAGCAGTAAATCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-2595s21c1
Sequence:CCGGGCAGTTTAAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-4116s21c1
Sequence:CCGGGAACGTGAATGCTTAAGATTTCTCGAGAAATCTTAAGCATTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-1988s21c1
Sequence:CCGGGCAGTCGTATTCAGAGATAAACTCGAGTTTATCTCTGAATACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018117.10-2386s21c1
Sequence:CCGGCGCTTGGAAAGGTGATACATTCTCGAGAATGTATCACCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018117.10-1180s21c1
Sequence:CCGGACGTGTTCGAAGATCTTATAACTCGAGTTATAAGATCTTCGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018117
VALIDATED
WDR11 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018117.10-1988s1c1
Sequence:CCGGGCAGTCGTATTCAGAGATAAACTCGAGTTTATCTCTGAATACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018117.10-2386s1c1
Sequence:CCGGCGCTTGGAAAGGTGATACATTCTCGAGAATGTATCACCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018117.10-3916s1c1
Sequence:CCGGGCTTAATAAATGCCAGGGAATCTCGAGATTCCCTGGCATTTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018117.10-2595s1c1
Sequence:CCGGGCAGTTTAAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018117.10-622s1c1
Sequence:CCGGCCGCGATTTACTGCTTGCTATCTCGAGATAGCAAGCAGTAAATCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-2595s21c1
Sequence:CCGGGCAGTTTAAGAAGTGGCAGAACTCGAGTTCTGCCACTTCTTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-4116s21c1
Sequence:CCGGGAACGTGAATGCTTAAGATTTCTCGAGAAATCTTAAGCATTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018117.10-1988s21c1
Sequence:CCGGGCAGTCGTATTCAGAGATAAACTCGAGTTTATCTCTGAATACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018117.10-2386s21c1
Sequence:CCGGCGCTTGGAAAGGTGATACATTCTCGAGAATGTATCACCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018117.10-1180s21c1
Sequence:CCGGACGTGTTCGAAGATCTTATAACTCGAGTTATAAGATCTTCGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks