EMAIL THIS PAGE TO A FRIEND

WDR12

WD repeat domain 12

Synonyms: YTM1
UniProtKB ID: Q9GZL7, B3KPA9, Q96HU0, Q9NV80, Q9NYI8
Gene ID:
Human(55759) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein is highly similar to the mouse WD repeat domain 12 protein at the amino acid level. The protein encoded by this gene is a component of a nucleolar protein complex that affects maturation of the large ribosomal subunit.[provided by RefSeq, Dec 2008]
Mouse(57750) WD repeat domain 12
Rat(363237) WD repeat domain 12
Zebrafish(321652) WD repeat domain 12
chicken(424089) WD repeat domain 12
dog(478876) WD repeat domain 12
domestic cat(101097082) WD repeat domain 12
cow(528209) WD repeat domain 12
sheep(101112032) WD repeat domain 12
domestic guinea pig(100723841) WD repeat domain 12
naked mole-rat(101697621) WD repeat domain 12
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41317 Anti-WDR12 antibody produced in rabbit IgG fraction of antiserum rat, mouse, rabbit, canine, bovine, human, guinea pig, horse
western blot pricing
HPA036389 Anti-WDR12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunohistochemistry, western blot pricing
SAB2701472 Anti-WDR12 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, western blot pricing
SAB2106548 Anti-WDR12 antibody produced in rabbit affinity isolated antibody mouse, human, guinea pig, horse, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018256 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018256 Rosetta Predictions human pricing
NM_199410 Rosetta Predictions rat pricing
NM_021312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195193 predicted 833
2 SASI_Hs02_00351612 predicted 1485
3 SASI_Hs01_00195195 predicted 906
4 SASI_Hs01_00195196 predicted 222
5 SASI_Hs01_00195197 predicted 667
6 SASI_Hs01_00195198 predicted 1261
7 SASI_Hs01_00195200 predicted 916
8 SASI_Hs02_00351613 predicted 1136
9 SASI_Hs01_00195201 predicted 866
10 SASI_Hs01_00195202 predicted 698
11 SASI_Hs01_00195194 predicted 495
12 SASI_Hs01_00195199 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074296 predicted 714
2 SASI_Rn01_00074297 predicted 900
3 SASI_Rn01_00074298 predicted 845
4 SASI_Rn02_00270241 predicted 215
5 SASI_Rn01_00074299 predicted 207
6 SASI_Rn01_00074300 predicted 1041
7 SASI_Rn01_00074301 predicted 650
8 SASI_Rn01_00074302 predicted 772
9 SASI_Rn02_00270242 predicted 850
10 SASI_Rn01_00074303 predicted 627
11 SASI_Rn01_00074304 predicted 712
12 SASI_Rn01_00074305 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163907 predicted 1623
2 SASI_Mm02_00325857 predicted 1449
3 SASI_Mm02_00325858 predicted 339
4 SASI_Mm02_00325859 predicted 379
5 SASI_Mm02_00325860 predicted 341
6 SASI_Mm01_00163908 predicted 1651
7 SASI_Mm01_00163910 predicted 713
8 SASI_Mm02_00325861 predicted 571
9 SASI_Mm02_00325862 predicted 373
10 SASI_Mm02_00325863 predicted 427
11 SASI_Mm01_00163909 predicted 1681
12 SASI_Mm01_00163911 predicted 710
13 SASI_Mm01_00163912 predicted 1670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021312
VALIDATED
WDR12 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1934s21c1
Sequence:CCGGGATAATCCTCTGATATCATTGCTCGAGCAATGATATCAGAGGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-2031s21c1
Sequence:CCGGTTTGTCCTTCGTGCTTATAAACTCGAGTTTATAAGCACGAAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1988s21c1
Sequence:CCGGTTGGATAACAGTTCATCTTTCCTCGAGGAAAGATGAACTGTTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1651s21c1
Sequence:CCGGCTTAGTGTCTCACTGTTATTTCTCGAGAAATAACAGTGAGACACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1861s21c1
Sequence:CCGGTGCTGTATAGTGAGCTTAAAGCTCGAGCTTTAAGCTCACTATACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-989s1c1
Sequence:CCGGCCTACAGATGAAGAAGATGAACTCGAGTTCATCTTCTTCATCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-673s1c1
Sequence:CCGGCCTGTCTGGTTCTTATGATAACTCGAGTTATCATAAGAACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-484s1c1
Sequence:CCGGCGAGTTTGATTTCCTTATCAACTCGAGTTGATAAGGAAATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-1308s1c1
Sequence:CCGGCCCGAACTAAAGATGGTTCTTCTCGAGAAGAACCATCTTTAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021312.4-1716s1c1
Sequence:CCGGGCTGGTAGAATGCTTGCCTAACTCGAGTTAGGCAAGCATTCTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021312
VALIDATED
WDR12 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1934s21c1
Sequence:CCGGGATAATCCTCTGATATCATTGCTCGAGCAATGATATCAGAGGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-2031s21c1
Sequence:CCGGTTTGTCCTTCGTGCTTATAAACTCGAGTTTATAAGCACGAAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1988s21c1
Sequence:CCGGTTGGATAACAGTTCATCTTTCCTCGAGGAAAGATGAACTGTTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1651s21c1
Sequence:CCGGCTTAGTGTCTCACTGTTATTTCTCGAGAAATAACAGTGAGACACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1861s21c1
Sequence:CCGGTGCTGTATAGTGAGCTTAAAGCTCGAGCTTTAAGCTCACTATACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-989s1c1
Sequence:CCGGCCTACAGATGAAGAAGATGAACTCGAGTTCATCTTCTTCATCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-673s1c1
Sequence:CCGGCCTGTCTGGTTCTTATGATAACTCGAGTTATCATAAGAACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-484s1c1
Sequence:CCGGCGAGTTTGATTTCCTTATCAACTCGAGTTGATAAGGAAATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-1308s1c1
Sequence:CCGGCCCGAACTAAAGATGGTTCTTCTCGAGAAGAACCATCTTTAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021312.4-1716s1c1
Sequence:CCGGGCTGGTAGAATGCTTGCCTAACTCGAGTTAGGCAAGCATTCTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021312
VALIDATED
WDR12 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1934s21c1
Sequence:CCGGGATAATCCTCTGATATCATTGCTCGAGCAATGATATCAGAGGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-2031s21c1
Sequence:CCGGTTTGTCCTTCGTGCTTATAAACTCGAGTTTATAAGCACGAAGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1988s21c1
Sequence:CCGGTTGGATAACAGTTCATCTTTCCTCGAGGAAAGATGAACTGTTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1651s21c1
Sequence:CCGGCTTAGTGTCTCACTGTTATTTCTCGAGAAATAACAGTGAGACACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021312.4-1861s21c1
Sequence:CCGGTGCTGTATAGTGAGCTTAAAGCTCGAGCTTTAAGCTCACTATACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-989s1c1
Sequence:CCGGCCTACAGATGAAGAAGATGAACTCGAGTTCATCTTCTTCATCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-673s1c1
Sequence:CCGGCCTGTCTGGTTCTTATGATAACTCGAGTTATCATAAGAACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-484s1c1
Sequence:CCGGCGAGTTTGATTTCCTTATCAACTCGAGTTGATAAGGAAATCAAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021312.4-1308s1c1
Sequence:CCGGCCCGAACTAAAGATGGTTCTTCTCGAGAAGAACCATCTTTAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021312.4-1716s1c1
Sequence:CCGGGCTGGTAGAATGCTTGCCTAACTCGAGTTAGGCAAGCATTCTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018256
VALIDATED
WDR12 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 12
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1232s21c1
Sequence:CCGGCTTCTATGGATCAGACTATTCCTCGAGGAATAGTCTGATCCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1087s21c1
Sequence:CCGGTGGATCTTGACTGGTTCTTATCTCGAGATAAGAACCAGTCAAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-2067s21c1
Sequence:CCGGATTGGTAGAGAACCATGAAATCTCGAGATTTCATGGTTCTCTACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1342s21c1
Sequence:CCGGGATGGCTCAGGAACTAAATTTCTCGAGAAATTTAGTTCCTGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1054s21c1
Sequence:CCGGGACTGGATCAGTTCAATTAAACTCGAGTTTAATTGAACTGATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018256.3-1692s21c1
Sequence:CCGGTGGAAGCACAGATAGGCATATCTCGAGATATGCCTATCTGTGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018256.3-2038s21c1
Sequence:CCGGTGACTATAGAGATTATTTCTGCTCGAGCAGAAATAATCTCTATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1612s21c1
Sequence:CCGGGGCAGTCTTAAGTCAACTTTGCTCGAGCAAAGTTGACTTAAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1204s21c1
Sequence:CCGGGATAGTTTGTCCTGCTTATTACTCGAGTAATAAGCAGGACAAACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018256.3-1667s21c1
Sequence:CCGGCTCCACTTTGTAAACGTTTAGCTCGAGCTAAACGTTTACAAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018256.2-659s1c1
Sequence:CCGGCCTGCTTATTATTGAGTGCTTCTCGAGAAGCACTCAATAATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018256.2-1543s1c1
Sequence:CCGGCAGATGCAGAAAGCAGCCTTTCTCGAGAAAGGCTGCTTTCTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018256.2-288s1c1
Sequence:CCGGCGACCTTAGTAACATCATCAACTCGAGTTGATGATGTTACTAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018256.2-575s1c1
Sequence:CCGGCCTTGGAAGGAAAGTCAATAACTCGAGTTATTGACTTTCCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018256
VALIDATED
WDR12 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 12
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1232s21c1
Sequence:CCGGCTTCTATGGATCAGACTATTCCTCGAGGAATAGTCTGATCCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1087s21c1
Sequence:CCGGTGGATCTTGACTGGTTCTTATCTCGAGATAAGAACCAGTCAAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-2067s21c1
Sequence:CCGGATTGGTAGAGAACCATGAAATCTCGAGATTTCATGGTTCTCTACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1342s21c1
Sequence:CCGGGATGGCTCAGGAACTAAATTTCTCGAGAAATTTAGTTCCTGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1054s21c1
Sequence:CCGGGACTGGATCAGTTCAATTAAACTCGAGTTTAATTGAACTGATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018256.3-1692s21c1
Sequence:CCGGTGGAAGCACAGATAGGCATATCTCGAGATATGCCTATCTGTGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018256.3-2038s21c1
Sequence:CCGGTGACTATAGAGATTATTTCTGCTCGAGCAGAAATAATCTCTATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1612s21c1
Sequence:CCGGGGCAGTCTTAAGTCAACTTTGCTCGAGCAAAGTTGACTTAAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1204s21c1
Sequence:CCGGGATAGTTTGTCCTGCTTATTACTCGAGTAATAAGCAGGACAAACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018256.3-1667s21c1
Sequence:CCGGCTCCACTTTGTAAACGTTTAGCTCGAGCTAAACGTTTACAAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018256.2-659s1c1
Sequence:CCGGCCTGCTTATTATTGAGTGCTTCTCGAGAAGCACTCAATAATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018256.2-1543s1c1
Sequence:CCGGCAGATGCAGAAAGCAGCCTTTCTCGAGAAAGGCTGCTTTCTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018256.2-288s1c1
Sequence:CCGGCGACCTTAGTAACATCATCAACTCGAGTTGATGATGTTACTAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018256.2-575s1c1
Sequence:CCGGCCTTGGAAGGAAAGTCAATAACTCGAGTTATTGACTTTCCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018256
VALIDATED
WDR12 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 12
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1232s21c1
Sequence:CCGGCTTCTATGGATCAGACTATTCCTCGAGGAATAGTCTGATCCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1087s21c1
Sequence:CCGGTGGATCTTGACTGGTTCTTATCTCGAGATAAGAACCAGTCAAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-2067s21c1
Sequence:CCGGATTGGTAGAGAACCATGAAATCTCGAGATTTCATGGTTCTCTACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1342s21c1
Sequence:CCGGGATGGCTCAGGAACTAAATTTCTCGAGAAATTTAGTTCCTGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1054s21c1
Sequence:CCGGGACTGGATCAGTTCAATTAAACTCGAGTTTAATTGAACTGATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018256.3-1692s21c1
Sequence:CCGGTGGAAGCACAGATAGGCATATCTCGAGATATGCCTATCTGTGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018256.3-2038s21c1
Sequence:CCGGTGACTATAGAGATTATTTCTGCTCGAGCAGAAATAATCTCTATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1612s21c1
Sequence:CCGGGGCAGTCTTAAGTCAACTTTGCTCGAGCAAAGTTGACTTAAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018256.3-1204s21c1
Sequence:CCGGGATAGTTTGTCCTGCTTATTACTCGAGTAATAAGCAGGACAAACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018256.3-1667s21c1
Sequence:CCGGCTCCACTTTGTAAACGTTTAGCTCGAGCTAAACGTTTACAAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018256.2-659s1c1
Sequence:CCGGCCTGCTTATTATTGAGTGCTTCTCGAGAAGCACTCAATAATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018256.2-1543s1c1
Sequence:CCGGCAGATGCAGAAAGCAGCCTTTCTCGAGAAAGGCTGCTTTCTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018256.2-288s1c1
Sequence:CCGGCGACCTTAGTAACATCATCAACTCGAGTTGATGATGTTACTAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018256.2-575s1c1
Sequence:CCGGCCTTGGAAGGAAAGTCAATAACTCGAGTTATTGACTTTCCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks