EMAIL THIS PAGE TO A FRIEND

WDR13

WD repeat domain 13

Synonyms: MG21
UniProtKB ID: Q9H1Z4, Q06DX1, Q9BUL7, Q9NWW4
Gene ID:
Human(64743) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by Gly-His and Trp-Asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is widely expressed in various tissues. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2009]
Mouse(73447) WD repeat domain 13
Rat(317370) WD repeat domain 13
naked mole-rat(101703147) WD repeat domain 13
domestic guinea pig(100730690) WD repeat domain 13
cow(523881) WD repeat domain 13
sheep(101110568) WD repeat domain 13
Zebrafish(334827) WD repeat domain 13
chicken(776425) WD repeat domain 13
dog(480904) WD repeat domain 13
domestic cat(101095316) WD repeat domain 13
Horse(100062003) WD repeat domain 13
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017883 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017883 Rosetta Predictions human pricing
NM_001108247 Rosetta Predictions rat pricing
NM_026137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221582 predicted 1697
2 SASI_Hs01_00221583 predicted 551
3 SASI_Hs01_00221584 predicted 1770
4 SASI_Hs01_00221585 predicted 508
5 SASI_Hs01_00221586 predicted 1764
6 SASI_Hs01_00221587 predicted 954
7 SASI_Hs01_00221588 predicted 846
8 SASI_Hs01_00221589 predicted 1585
9 SASI_Hs01_00221591 predicted 848
10 SASI_Hs02_00350827 predicted 1503
11 SASI_Hs01_00221590 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236774 predicted 1135
2 SASI_Rn02_00236775 predicted 967
3 SASI_Rn02_00236776 predicted 736
4 SASI_Rn02_00236777 predicted 978
5 SASI_Rn02_00236778 predicted 282
6 SASI_Rn02_00236779 predicted 306
7 SASI_Rn02_00236780 predicted 625
8 SASI_Rn02_00236781 predicted 1251
9 SASI_Rn02_00236782 predicted 409
10 SASI_Rn02_00236783 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171279 predicted 1393
2 SASI_Mm01_00171280 predicted 1485
3 SASI_Mm01_00171281 predicted 888
4 SASI_Mm01_00171282 predicted 1856
5 SASI_Mm01_00171283 predicted 360
6 SASI_Mm01_00171284 predicted 1390
7 SASI_Mm01_00171285 predicted 285
8 SASI_Mm01_00171286 predicted 585
9 SASI_Mm01_00171287 predicted 467
10 SASI_Mm02_00329741 predicted 1382
11 SASI_Mm01_00171288 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017883
VALIDATED
WDR13 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1466s1c1
Sequence:CCGGGTCTTCTCTTTCCTCTTTGATCTCGAGATCAAAGAGGAAAGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1780s1c1
Sequence:CCGGCGTGCACTTCTTTGATGTGGACTCGAGTCCACATCAAAGAAGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1403s1c1
Sequence:CCGGGTCCTTGCTCTGTCCTTTGATCTCGAGATCAAAGGACAGAGCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1348s1c1
Sequence:CCGGGAACATCTCCACAGGCAAGAACTCGAGTTCTTGCCTGTGGAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017883.3-1589s1c1
Sequence:CCGGGATCCCTCACTGCTCATCAATCTCGAGATTGATGAGCAGTGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1466s21c1
Sequence:CCGGGTCTTCTCTTTCCTCTTTGATCTCGAGATCAAAGAGGAAAGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1780s21c1
Sequence:CCGGCGTGCACTTCTTTGATGTGGACTCGAGTCCACATCAAAGAAGTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1403s21c1
Sequence:CCGGGTCCTTGCTCTGTCCTTTGATCTCGAGATCAAAGGACAGAGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-849s21c1
Sequence:CCGGAGATGAACCGTGCCGTCTATGCTCGAGCATAGACGGCACGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017883
VALIDATED
WDR13 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1466s1c1
Sequence:CCGGGTCTTCTCTTTCCTCTTTGATCTCGAGATCAAAGAGGAAAGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1780s1c1
Sequence:CCGGCGTGCACTTCTTTGATGTGGACTCGAGTCCACATCAAAGAAGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1403s1c1
Sequence:CCGGGTCCTTGCTCTGTCCTTTGATCTCGAGATCAAAGGACAGAGCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1348s1c1
Sequence:CCGGGAACATCTCCACAGGCAAGAACTCGAGTTCTTGCCTGTGGAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017883.3-1589s1c1
Sequence:CCGGGATCCCTCACTGCTCATCAATCTCGAGATTGATGAGCAGTGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1466s21c1
Sequence:CCGGGTCTTCTCTTTCCTCTTTGATCTCGAGATCAAAGAGGAAAGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1780s21c1
Sequence:CCGGCGTGCACTTCTTTGATGTGGACTCGAGTCCACATCAAAGAAGTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1403s21c1
Sequence:CCGGGTCCTTGCTCTGTCCTTTGATCTCGAGATCAAAGGACAGAGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-849s21c1
Sequence:CCGGAGATGAACCGTGCCGTCTATGCTCGAGCATAGACGGCACGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017883
VALIDATED
WDR13 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1466s1c1
Sequence:CCGGGTCTTCTCTTTCCTCTTTGATCTCGAGATCAAAGAGGAAAGAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1780s1c1
Sequence:CCGGCGTGCACTTCTTTGATGTGGACTCGAGTCCACATCAAAGAAGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1403s1c1
Sequence:CCGGGTCCTTGCTCTGTCCTTTGATCTCGAGATCAAAGGACAGAGCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017883.3-1348s1c1
Sequence:CCGGGAACATCTCCACAGGCAAGAACTCGAGTTCTTGCCTGTGGAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017883.3-1589s1c1
Sequence:CCGGGATCCCTCACTGCTCATCAATCTCGAGATTGATGAGCAGTGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1466s21c1
Sequence:CCGGGTCTTCTCTTTCCTCTTTGATCTCGAGATCAAAGAGGAAAGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1780s21c1
Sequence:CCGGCGTGCACTTCTTTGATGTGGACTCGAGTCCACATCAAAGAAGTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-1403s21c1
Sequence:CCGGGTCCTTGCTCTGTCCTTTGATCTCGAGATCAAAGGACAGAGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017883.3-849s21c1
Sequence:CCGGAGATGAACCGTGCCGTCTATGCTCGAGCATAGACGGCACGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026137
VALIDATED
WDR13 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-572s1c1
Sequence:CCGGGCTGAGTGAGAACTATGCCTTCTCGAGAAGGCATAGTTCTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-974s1c1
Sequence:CCGGCATGAACATCTCCACAGGCAACTCGAGTTGCCTGTGGAGATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-371s1c1
Sequence:CCGGCCGAACAACCCTTGATCGAATCTCGAGATTCGATCAAGGGTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-1397s1c1
Sequence:CCGGTGAAGATATGTGCGTTCACTTCTCGAGAAGTGAACGCACATATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026137.2-3096s1c1
Sequence:CCGGGCTACTACATTTGTAGCAATTCTCGAGAATTGCTACAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026137.3-972s21c1
Sequence:CCGGCATGAACATCTCCACAGGCAACTCGAGTTGCCTGTGGAGATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-566s21c1
Sequence:CCGGCGTCGCTGAGTGAGAACTATGCTCGAGCATAGTTCTCACTCAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-459s21c1
Sequence:CCGGCTACCAGCTGCAGGCACAAATCTCGAGATTTGTGCCTGCAGCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-1610s21c1
Sequence:CCGGCACTCCAGTCTTGCGTTATAACTCGAGTTATAACGCAAGACTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026137.3-183s21c1
Sequence:CCGGACAGTTTCGGACCCAGTATATCTCGAGATATACTGGGTCCGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026137
VALIDATED
WDR13 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-572s1c1
Sequence:CCGGGCTGAGTGAGAACTATGCCTTCTCGAGAAGGCATAGTTCTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-974s1c1
Sequence:CCGGCATGAACATCTCCACAGGCAACTCGAGTTGCCTGTGGAGATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-371s1c1
Sequence:CCGGCCGAACAACCCTTGATCGAATCTCGAGATTCGATCAAGGGTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-1397s1c1
Sequence:CCGGTGAAGATATGTGCGTTCACTTCTCGAGAAGTGAACGCACATATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026137.2-3096s1c1
Sequence:CCGGGCTACTACATTTGTAGCAATTCTCGAGAATTGCTACAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026137.3-972s21c1
Sequence:CCGGCATGAACATCTCCACAGGCAACTCGAGTTGCCTGTGGAGATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-566s21c1
Sequence:CCGGCGTCGCTGAGTGAGAACTATGCTCGAGCATAGTTCTCACTCAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-459s21c1
Sequence:CCGGCTACCAGCTGCAGGCACAAATCTCGAGATTTGTGCCTGCAGCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-1610s21c1
Sequence:CCGGCACTCCAGTCTTGCGTTATAACTCGAGTTATAACGCAAGACTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026137.3-183s21c1
Sequence:CCGGACAGTTTCGGACCCAGTATATCTCGAGATATACTGGGTCCGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026137
VALIDATED
WDR13 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-572s1c1
Sequence:CCGGGCTGAGTGAGAACTATGCCTTCTCGAGAAGGCATAGTTCTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-974s1c1
Sequence:CCGGCATGAACATCTCCACAGGCAACTCGAGTTGCCTGTGGAGATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-371s1c1
Sequence:CCGGCCGAACAACCCTTGATCGAATCTCGAGATTCGATCAAGGGTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026137.2-1397s1c1
Sequence:CCGGTGAAGATATGTGCGTTCACTTCTCGAGAAGTGAACGCACATATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026137.2-3096s1c1
Sequence:CCGGGCTACTACATTTGTAGCAATTCTCGAGAATTGCTACAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026137.3-972s21c1
Sequence:CCGGCATGAACATCTCCACAGGCAACTCGAGTTGCCTGTGGAGATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-566s21c1
Sequence:CCGGCGTCGCTGAGTGAGAACTATGCTCGAGCATAGTTCTCACTCAGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-459s21c1
Sequence:CCGGCTACCAGCTGCAGGCACAAATCTCGAGATTTGTGCCTGCAGCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026137.3-1610s21c1
Sequence:CCGGCACTCCAGTCTTGCGTTATAACTCGAGTTATAACGCAAGACTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026137.3-183s21c1
Sequence:CCGGACAGTTTCGGACCCAGTATATCTCGAGATATACTGGGTCCGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks