EMAIL THIS PAGE TO A FRIEND

WDR16

WD repeat domain 16

Synonyms: WDRPUH
UniProtKB ID: Q8N1V2, B2RDU7, Q5DX23, Q8TC73, Q8TCI3
Gene ID:
Human(146845) Summary: WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]
Mouse(71860) WD repeat domain 16
Rat(303233) WD repeat domain 16
Zebrafish(553666) WD repeat domain 16
chicken(417322) WD repeat domain 16
domestic cat(101083722) WD repeat domain 16
Horse(100062832) WD repeat domain 16
dog(479500) WD repeat domain 16
cow(505885) WD repeat domain 16
sheep(101110523) WD repeat domain 16
naked mole-rat(101722827) WD repeat domain 16
Domestic Rabbit(100339764) WD repeat domain 16
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145054 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037306 Rosetta Predictions human pricing
NM_001080556 Rosetta Predictions human pricing
NM_145054 Rosetta Predictions human pricing
NM_001100968 Rosetta Predictions rat pricing
NM_027963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221842 predicted 1048
2 SASI_Hs01_00221843 predicted 1832
3 SASI_Hs01_00221844 predicted 1697
4 SASI_Hs01_00221845 predicted 1279
5 SASI_Hs01_00221846 predicted 1546
6 SASI_Hs01_00221847 predicted 977
7 SASI_Hs01_00221848 predicted 607
8 SASI_Hs01_00221849 predicted 1621
9 SASI_Hs01_00221850 predicted 923
10 SASI_Hs01_00221851 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315920 predicted 855
2 SASI_Hs02_00315921 predicted 1643
3 SASI_Hs02_00315922 predicted 707
4 SASI_Hs02_00315923 predicted 1498
5 SASI_Hs02_00315924 predicted 1357
6 SASI_Hs02_00315925 predicted 409
7 SASI_Hs02_00315926 predicted 485
8 SASI_Hs02_00315927 predicted 1426
9 SASI_Hs02_00315928 predicted 728
10 SASI_Hs02_00315929 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042012 predicted 1056
2 SASI_Hs01_00042013 predicted 1843
3 SASI_Hs02_00364941 predicted 911
4 SASI_Hs01_00042014 predicted 1703
5 SASI_Hs01_00042016 predicted 1553
6 SASI_Hs01_00042018 predicted 614
7 SASI_Hs02_00364942 predicted 688
8 SASI_Hs01_00042019 predicted 1633
9 SASI_Hs01_00042020 predicted 931
10 SASI_Hs02_00364943 predicted 1612
11 SASI_Hs01_00042015 predicted 1465
12 SASI_Hs01_00042017 predicted 1165
13 SASI_Hs01_00042021 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210822 predicted 1020
2 SASI_Rn02_00210823 predicted 1616
3 SASI_Rn02_00210824 predicted 1619
4 SASI_Rn02_00210825 predicted 206
5 SASI_Rn02_00210826 predicted 1878
6 SASI_Rn02_00210827 predicted 1108
7 SASI_Rn02_00210828 predicted 1008
8 SASI_Rn02_00210829 predicted 312
9 SASI_Rn02_00210830 predicted 315
10 SASI_Rn02_00210831 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035815 predicted 1026
2 SASI_Mm02_00332999 predicted 1185
3 SASI_Mm02_00333000 predicted 1272
4 SASI_Mm02_00333001 predicted 1558
5 SASI_Mm01_00035818 predicted 1683
6 SASI_Mm01_00035819 predicted 1011
7 SASI_Mm01_00035820 predicted 326
8 SASI_Mm02_00333002 predicted 220
9 SASI_Mm01_00035822 predicted 321
10 SASI_Mm01_00035823 predicted 984
11 SASI_Mm01_00035816 predicted 1618
12 SASI_Mm01_00035817 predicted 1624
13 SASI_Mm01_00035821 predicted 1618
14 SASI_Mm01_00035824 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027963
WDR16 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 16
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1837s21c1
Sequence:CCGGAGTCCAGGAAACCAGTATATCCTCGAGGATATACTGGTTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1493s21c1
Sequence:CCGGCCGATGGGACATGCATCATTTCTCGAGAAATGATGCATGTCCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027963.2-2017s21c1
Sequence:CCGGTTTGCCCTATAGTCAAATTACCTCGAGGTAATTTGACTATAGGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1269s21c1
Sequence:CCGGTCGGCTGATGTACACCATTAACTCGAGTTAATGGTGTACATCAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027963.2-2021s1c1
Sequence:CCGGCCCTATAGTCAAATTACTTTACTCGAGTAAAGTAATTTGACTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-984s21c1
Sequence:CCGGATCGCACATCTACCGCGTTAACTCGAGTTAACGCGGTAGATGTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027963.1-1683s1c1
Sequence:CCGGGTCTGGGTCCATCAATGGTATCTCGAGATACCATTGATGGACCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027963.1-918s1c1
Sequence:CCGGGCAAGGTGGTATCACCTCTATCTCGAGATAGAGGTGATACCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027963
WDR16 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 16
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1837s21c1
Sequence:CCGGAGTCCAGGAAACCAGTATATCCTCGAGGATATACTGGTTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1493s21c1
Sequence:CCGGCCGATGGGACATGCATCATTTCTCGAGAAATGATGCATGTCCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027963.2-2017s21c1
Sequence:CCGGTTTGCCCTATAGTCAAATTACCTCGAGGTAATTTGACTATAGGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1269s21c1
Sequence:CCGGTCGGCTGATGTACACCATTAACTCGAGTTAATGGTGTACATCAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027963.2-2021s1c1
Sequence:CCGGCCCTATAGTCAAATTACTTTACTCGAGTAAAGTAATTTGACTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-984s21c1
Sequence:CCGGATCGCACATCTACCGCGTTAACTCGAGTTAACGCGGTAGATGTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027963.1-1683s1c1
Sequence:CCGGGTCTGGGTCCATCAATGGTATCTCGAGATACCATTGATGGACCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027963.1-918s1c1
Sequence:CCGGGCAAGGTGGTATCACCTCTATCTCGAGATAGAGGTGATACCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027963
WDR16 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 16
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1837s21c1
Sequence:CCGGAGTCCAGGAAACCAGTATATCCTCGAGGATATACTGGTTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1493s21c1
Sequence:CCGGCCGATGGGACATGCATCATTTCTCGAGAAATGATGCATGTCCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027963.2-2017s21c1
Sequence:CCGGTTTGCCCTATAGTCAAATTACCTCGAGGTAATTTGACTATAGGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-1269s21c1
Sequence:CCGGTCGGCTGATGTACACCATTAACTCGAGTTAATGGTGTACATCAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027963.2-2021s1c1
Sequence:CCGGCCCTATAGTCAAATTACTTTACTCGAGTAAAGTAATTTGACTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027963.2-984s21c1
Sequence:CCGGATCGCACATCTACCGCGTTAACTCGAGTTAACGCGGTAGATGTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027963.1-1683s1c1
Sequence:CCGGGTCTGGGTCCATCAATGGTATCTCGAGATACCATTGATGGACCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027963.1-918s1c1
Sequence:CCGGGCAAGGTGGTATCACCTCTATCTCGAGATAGAGGTGATACCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145054
WDR16 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145054.2-355s1c1
Sequence:CCGGGTCCTCATTCAGGCAATAAATCTCGAGATTTATTGCCTGAATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145054.2-1996s1c1
Sequence:CCGGCGCATAAGTCCAGGAAATCAACTCGAGTTGATTTCCTGGACTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145054.2-1997s1c1
Sequence:CCGGGCATAAGTCCAGGAAATCAATCTCGAGATTGATTTCCTGGACTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1658s1c1
Sequence:CCGGCCGATGGGACTTGTATCATTTCTCGAGAAATGATACAAGTCCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1152s1c1
Sequence:CCGGGCACATTTATCGTGTCAGCTTCTCGAGAAGCTGACACGATAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145054.2-732s1c1
Sequence:CCGGGATGTTTATGACTGCTGGAAACTCGAGTTTCCAGCAGTCATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1063s1c1
Sequence:CCGGCCCATCAAGAAGATTCAGTTACTCGAGTAACTGAATCTTCTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1791s1c1
Sequence:CCGGGATTGCTTACTGGGAAGTATTCTCGAGAATACTTCCCAGTAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145054
WDR16 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145054.2-355s1c1
Sequence:CCGGGTCCTCATTCAGGCAATAAATCTCGAGATTTATTGCCTGAATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145054.2-1996s1c1
Sequence:CCGGCGCATAAGTCCAGGAAATCAACTCGAGTTGATTTCCTGGACTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145054.2-1997s1c1
Sequence:CCGGGCATAAGTCCAGGAAATCAATCTCGAGATTGATTTCCTGGACTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1658s1c1
Sequence:CCGGCCGATGGGACTTGTATCATTTCTCGAGAAATGATACAAGTCCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1152s1c1
Sequence:CCGGGCACATTTATCGTGTCAGCTTCTCGAGAAGCTGACACGATAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145054.2-732s1c1
Sequence:CCGGGATGTTTATGACTGCTGGAAACTCGAGTTTCCAGCAGTCATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1063s1c1
Sequence:CCGGCCCATCAAGAAGATTCAGTTACTCGAGTAACTGAATCTTCTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1791s1c1
Sequence:CCGGGATTGCTTACTGGGAAGTATTCTCGAGAATACTTCCCAGTAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145054
WDR16 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145054.2-355s1c1
Sequence:CCGGGTCCTCATTCAGGCAATAAATCTCGAGATTTATTGCCTGAATGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145054.2-1996s1c1
Sequence:CCGGCGCATAAGTCCAGGAAATCAACTCGAGTTGATTTCCTGGACTTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145054.2-1997s1c1
Sequence:CCGGGCATAAGTCCAGGAAATCAATCTCGAGATTGATTTCCTGGACTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1658s1c1
Sequence:CCGGCCGATGGGACTTGTATCATTTCTCGAGAAATGATACAAGTCCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1152s1c1
Sequence:CCGGGCACATTTATCGTGTCAGCTTCTCGAGAAGCTGACACGATAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145054.2-732s1c1
Sequence:CCGGGATGTTTATGACTGCTGGAAACTCGAGTTTCCAGCAGTCATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1063s1c1
Sequence:CCGGCCCATCAAGAAGATTCAGTTACTCGAGTAACTGAATCTTCTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145054.2-1791s1c1
Sequence:CCGGGATTGCTTACTGGGAAGTATTCTCGAGAATACTTCCCAGTAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks