EMAIL THIS PAGE TO A FRIEND

WDR17

WD repeat domain 17

UniProtKB ID: Q8IZU2, E7EQX0
Gene ID:
Human(116966) Summary: This gene encodes a WD repeat-containing protein. It is abundantly expressed in retina and testis, and is thought to be a candidate gene for retinal disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2009]
Mouse(244484) WD repeat domain 17
Rat(364653) WD repeat domain 17
naked mole-rat(101716633) WD repeat domain 17
domestic guinea pig(100722716) WD repeat domain 17
cow(783416) WD repeat domain 17
sheep(101107160) WD repeat domain 17
Zebrafish(561804) WD repeat domain 17
Horse(100146539) WD repeat domain 17
domestic cat(101084617) WD repeat domain 17
dog(482934) WD repeat domain 17
chicken(422570) WD repeat domain 17
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042766 Anti-WDR17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170710 Rosetta Predictions human pricing
NM_181265 Rosetta Predictions human pricing
XM_001056850 Rosetta Predictions rat pricing
XM_344557 Rosetta Predictions rat pricing
NM_028220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125604 predicted 3481
2 SASI_Hs02_00367656 predicted 3391
3 SASI_Hs01_00125605 predicted 631
4 SASI_Hs01_00125606 predicted 3163
5 SASI_Hs01_00125607 predicted 889
6 SASI_Hs01_00125608 predicted 506
7 SASI_Hs02_00367657 predicted 2617
8 SASI_Hs01_00125611 predicted 3566
9 SASI_Hs01_00125612 predicted 2538
10 SASI_Hs02_00367658 predicted 3912
11 SASI_Hs01_00125609 predicted 1107
12 SASI_Hs01_00125610 predicted 2848
13 SASI_Hs01_00125613 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054272 predicted 3363
2 SASI_Hs02_00369944 predicted 3264
3 SASI_Hs01_00054273 predicted 507
4 SASI_Hs01_00054274 predicted 3040
5 SASI_Hs01_00054275 predicted 770
6 SASI_Hs01_00054276 predicted 380
7 SASI_Hs02_00369945 predicted 2494
8 SASI_Hs01_00054279 predicted 3445
9 SASI_Hs01_00054280 predicted 2416
10 SASI_Hs02_00369946 predicted 3786
11 SASI_Hs01_00054277 predicted 980
12 SASI_Hs01_00054278 predicted 2728
13 SASI_Hs01_00054281 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284658 predicted 3120
2 SASI_Rn02_00284659 predicted 3394
3 SASI_Rn02_00284660 predicted 200
4 SASI_Rn02_00284661 predicted 2275
5 SASI_Rn02_00284662 predicted 3534
6 SASI_Rn02_00284663 predicted 739
7 SASI_Rn02_00284664 predicted 723
8 SASI_Rn02_00284665 predicted 952
9 SASI_Rn02_00284666 predicted 1469
10 SASI_Rn02_00284667 predicted 3260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397250 predicted 1798
2 SASI_Rn02_00397251 predicted 826
3 SASI_Rn02_00397252 predicted 888
4 SASI_Rn02_00397253 predicted 486
5 SASI_Rn02_00397254 predicted 2152
6 SASI_Rn02_00397255 predicted 1673
7 SASI_Rn02_00397256 predicted 614
8 SASI_Rn02_00397257 predicted 593
9 SASI_Rn02_00397258 predicted 815
10 SASI_Rn02_00397259 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034048 predicted 3782
2 SASI_Mm02_00333544 predicted 2968
3 SASI_Mm01_00034049 predicted 1999
4 SASI_Mm01_00034050 predicted 403
5 SASI_Mm01_00034051 predicted 3559
6 SASI_Mm01_00034052 predicted 2157
7 SASI_Mm01_00034053 predicted 1332
8 SASI_Mm01_00034057 predicted 2143
9 SASI_Mm02_00333545 predicted 1291
10 SASI_Mm02_00333546 predicted 1705
11 SASI_Mm01_00034054 predicted 1752
12 SASI_Mm01_00034055 predicted 3425
13 SASI_Mm01_00034056 predicted 2756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181265
VALIDATED
WDR17 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 17
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-226s1c1
Sequence:CCGGCAGTTGGATCACCGTTATAATCTCGAGATTATAACGGTGATCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181265.1-471s1c1
Sequence:CCGGCAACTCAGAGATGCAATGGATCTCGAGATCCATTGCATCTCTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-256s1c1
Sequence:CCGGCTTCACGCAATTATGTCTGAACTCGAGTTCAGACATAATTGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-296s1c1
Sequence:CCGGCAATTTCTTGGTGTCCACATACTCGAGTATGTGGACACCAAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-474s1c1
Sequence:CCGGCTCAGAGATGCAATGGATAATCTCGAGATTATCCATTGCATCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-3590s21c1
Sequence:CCGGAGTACACAAGTCAGCTATTAACTCGAGTTAATAGCTGACTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-728s21c1
Sequence:CCGGACCCACTATCTACTGATTATCCTCGAGGATAATCAGTAGATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181265.2-4371s21c1
Sequence:CCGGAGACATACAGTAAGTACTTAACTCGAGTTAAGTACTTACTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1331s21c1
Sequence:CCGGCGGGTAATGAAGGTGTTATTTCTCGAGAAATAACACCTTCATTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1860s21c1
Sequence:CCGGTGCACCTGTGAGAGGATTAATCTCGAGATTAATCCTCTCACAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-200s21c1
Sequence:CCGGGTGCGACCCTGGCTATCTATACTCGAGTATAGATAGCCAGGGTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-3442s21c1
Sequence:CCGGCTTGACCTACTGAGCTATATTCTCGAGAATATAGCTCAGTAGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1487s21c1
Sequence:CCGGGCATTGCCTGGAGTCATAAAGCTCGAGCTTTATGACTCCAGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181265
VALIDATED
WDR17 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 17
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-226s1c1
Sequence:CCGGCAGTTGGATCACCGTTATAATCTCGAGATTATAACGGTGATCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181265.1-471s1c1
Sequence:CCGGCAACTCAGAGATGCAATGGATCTCGAGATCCATTGCATCTCTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-256s1c1
Sequence:CCGGCTTCACGCAATTATGTCTGAACTCGAGTTCAGACATAATTGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-296s1c1
Sequence:CCGGCAATTTCTTGGTGTCCACATACTCGAGTATGTGGACACCAAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-474s1c1
Sequence:CCGGCTCAGAGATGCAATGGATAATCTCGAGATTATCCATTGCATCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-3590s21c1
Sequence:CCGGAGTACACAAGTCAGCTATTAACTCGAGTTAATAGCTGACTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-728s21c1
Sequence:CCGGACCCACTATCTACTGATTATCCTCGAGGATAATCAGTAGATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181265.2-4371s21c1
Sequence:CCGGAGACATACAGTAAGTACTTAACTCGAGTTAAGTACTTACTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1331s21c1
Sequence:CCGGCGGGTAATGAAGGTGTTATTTCTCGAGAAATAACACCTTCATTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1860s21c1
Sequence:CCGGTGCACCTGTGAGAGGATTAATCTCGAGATTAATCCTCTCACAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-200s21c1
Sequence:CCGGGTGCGACCCTGGCTATCTATACTCGAGTATAGATAGCCAGGGTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-3442s21c1
Sequence:CCGGCTTGACCTACTGAGCTATATTCTCGAGAATATAGCTCAGTAGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1487s21c1
Sequence:CCGGGCATTGCCTGGAGTCATAAAGCTCGAGCTTTATGACTCCAGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181265
VALIDATED
WDR17 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 17
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-226s1c1
Sequence:CCGGCAGTTGGATCACCGTTATAATCTCGAGATTATAACGGTGATCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181265.1-471s1c1
Sequence:CCGGCAACTCAGAGATGCAATGGATCTCGAGATCCATTGCATCTCTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-256s1c1
Sequence:CCGGCTTCACGCAATTATGTCTGAACTCGAGTTCAGACATAATTGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-296s1c1
Sequence:CCGGCAATTTCTTGGTGTCCACATACTCGAGTATGTGGACACCAAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181265.1-474s1c1
Sequence:CCGGCTCAGAGATGCAATGGATAATCTCGAGATTATCCATTGCATCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-3590s21c1
Sequence:CCGGAGTACACAAGTCAGCTATTAACTCGAGTTAATAGCTGACTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-728s21c1
Sequence:CCGGACCCACTATCTACTGATTATCCTCGAGGATAATCAGTAGATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181265.2-4371s21c1
Sequence:CCGGAGACATACAGTAAGTACTTAACTCGAGTTAAGTACTTACTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1331s21c1
Sequence:CCGGCGGGTAATGAAGGTGTTATTTCTCGAGAAATAACACCTTCATTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1860s21c1
Sequence:CCGGTGCACCTGTGAGAGGATTAATCTCGAGATTAATCCTCTCACAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-200s21c1
Sequence:CCGGGTGCGACCCTGGCTATCTATACTCGAGTATAGATAGCCAGGGTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-3442s21c1
Sequence:CCGGCTTGACCTACTGAGCTATATTCTCGAGAATATAGCTCAGTAGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181265.2-1487s21c1
Sequence:CCGGGCATTGCCTGGAGTCATAAAGCTCGAGCTTTATGACTCCAGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028220
WDR17 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 17
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-894s1c1
Sequence:CCGGGCATGTTTATAACTGGAGATTCTCGAGAATCTCCAGTTATAAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-411s1c1
Sequence:CCGGCCGATAACTTAGTGATCATTTCTCGAGAAATGATCACTAAGTTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-2946s1c1
Sequence:CCGGGCCATCTTGCTGTAGATGATACTCGAGTATCATCTACAGCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-2434s1c1
Sequence:CCGGCCAAGAACTAACGACAATCAACTCGAGTTGATTGTCGTTAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-617s1c1
Sequence:CCGGGCGTCTGACATTTGCATATTTCTCGAGAAATATGCAAATGTCAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028220.2-3505s1c1
Sequence:CCGGGCTTATCTTATGTGGTTACATCTCGAGATGTAACCACATAAGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028220.2-3609s1c1
Sequence:CCGGGAGTGGTGTCAGTACCATTAACTCGAGTTAATGGTACTGACACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028220
WDR17 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 17
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-894s1c1
Sequence:CCGGGCATGTTTATAACTGGAGATTCTCGAGAATCTCCAGTTATAAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-411s1c1
Sequence:CCGGCCGATAACTTAGTGATCATTTCTCGAGAAATGATCACTAAGTTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-2946s1c1
Sequence:CCGGGCCATCTTGCTGTAGATGATACTCGAGTATCATCTACAGCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-2434s1c1
Sequence:CCGGCCAAGAACTAACGACAATCAACTCGAGTTGATTGTCGTTAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-617s1c1
Sequence:CCGGGCGTCTGACATTTGCATATTTCTCGAGAAATATGCAAATGTCAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028220.2-3505s1c1
Sequence:CCGGGCTTATCTTATGTGGTTACATCTCGAGATGTAACCACATAAGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028220.2-3609s1c1
Sequence:CCGGGAGTGGTGTCAGTACCATTAACTCGAGTTAATGGTACTGACACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028220
WDR17 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 17
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-894s1c1
Sequence:CCGGGCATGTTTATAACTGGAGATTCTCGAGAATCTCCAGTTATAAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-411s1c1
Sequence:CCGGCCGATAACTTAGTGATCATTTCTCGAGAAATGATCACTAAGTTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-2946s1c1
Sequence:CCGGGCCATCTTGCTGTAGATGATACTCGAGTATCATCTACAGCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-2434s1c1
Sequence:CCGGCCAAGAACTAACGACAATCAACTCGAGTTGATTGTCGTTAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028220.2-617s1c1
Sequence:CCGGGCGTCTGACATTTGCATATTTCTCGAGAAATATGCAAATGTCAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028220.2-3505s1c1
Sequence:CCGGGCTTATCTTATGTGGTTACATCTCGAGATGTAACCACATAAGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028220.2-3609s1c1
Sequence:CCGGGAGTGGTGTCAGTACCATTAACTCGAGTTAATGGTACTGACACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks