EMAIL THIS PAGE TO A FRIEND

WDR18

WD repeat domain 18

Synonyms: Ipi3 R32184_1
UniProtKB ID: Q9BV38, O60390, Q9BWR2
Gene ID:
Human(57418) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Mouse(216156) WD repeat domain 18
Rat(314617) WD repeat domain 18
Zebrafish(445819) WD repeat domain 18
chicken(420100) WD repeat domain 18
domestic cat(101094484) WD repeat domain 18
dog(612368) WD repeat domain 18
cow(533356) WD repeat domain 18
sheep(101112137) WD repeat domain 18
domestic guinea pig(100725777) WD repeat domain 18
naked mole-rat(101711764) WD repeat domain 18
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0061 AQUA Peptide VTELEDEV[R] cow, human pricing
AQ0062 AQUA Peptide SVLGGQDQL[R] dog, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024100 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024100 Rosetta Predictions human pricing
NM_001039027 Rosetta Predictions rat pricing
NM_175450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356581 predicted 393
2 SASI_Hs01_00202847 predicted 822
3 SASI_Hs01_00202848 predicted 833
4 SASI_Hs01_00202849 predicted 368
5 SASI_Hs01_00202850 predicted 944
6 SASI_Hs01_00202851 predicted 806
7 SASI_Hs01_00202852 predicted 390
8 SASI_Hs01_00202853 predicted 610
9 SASI_Hs01_00202854 predicted 288
10 SASI_Hs01_00202855 predicted 323
11 SASI_Hs01_00202856 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051454 predicted 266
2 SASI_Rn01_00051455 predicted 816
3 SASI_Rn01_00051456 predicted 208
4 SASI_Rn02_00204775 predicted 940
5 SASI_Rn01_00051457 predicted 594
6 SASI_Rn01_00051458 predicted 302
7 SASI_Rn01_00051459 predicted 805
8 SASI_Rn01_00051460 predicted 774
9 SASI_Rn01_00051461 predicted 668
10 SASI_Rn01_00051462 predicted 1149
11 SASI_Rn01_00051463 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132152 predicted 1593
2 SASI_Mm01_00132153 predicted 1367
3 SASI_Mm01_00132154 predicted 267
4 SASI_Mm01_00132155 predicted 207
5 SASI_Mm01_00132156 predicted 310
6 SASI_Mm01_00132157 predicted 1547
7 SASI_Mm01_00132158 predicted 1577
8 SASI_Mm01_00132159 predicted 694
9 SASI_Mm01_00132160 predicted 1513
10 SASI_Mm01_00132161 predicted 1521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024100
VALIDATED
WDR18 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 18
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-280s21c1
Sequence:CCGGGTCTGACTGCATCACCCAATGCTCGAGCATTGGGTGATGCAGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024100.3-368s21c1
Sequence:CCGGGGTCATCCTGAGTCGACACTACTCGAGTAGTGTCGACTCAGGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024100.3-1265s21c1
Sequence:CCGGCAAGATCAATCGGGACCTGTTCTCGAGAACAGGTCCCGATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-1415s21c1
Sequence:CCGGGCCTGGACTCTCCTCAGTTCTCTCGAGAGAACTGAGGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-159s21c1
Sequence:CCGGGCGCTGCTCAATGGCGAGTATCTCGAGATACTCGCCATTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-1395s1c1
Sequence:CCGGGCCTGGACTCTCCTCAGTTCTCTCGAGAGAACTGAGGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-139s1c1
Sequence:CCGGGCGCTGCTCAATGGCGAGTATCTCGAGATACTCGCCATTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-596s1c1
Sequence:CCGGCGGTGAAGCTATGGGAGGTCTCTCGAGAGACCTCCCATAGCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024100.2-179s1c1
Sequence:CCGGGCAAGAATTACATCAGCGCCTCTCGAGAGGCGCTGATGTAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-1245s1c1
Sequence:CCGGCAAGATCAATCGGGACCTGTTCTCGAGAACAGGTCCCGATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024100
VALIDATED
WDR18 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 18
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-280s21c1
Sequence:CCGGGTCTGACTGCATCACCCAATGCTCGAGCATTGGGTGATGCAGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024100.3-368s21c1
Sequence:CCGGGGTCATCCTGAGTCGACACTACTCGAGTAGTGTCGACTCAGGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024100.3-1265s21c1
Sequence:CCGGCAAGATCAATCGGGACCTGTTCTCGAGAACAGGTCCCGATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-1415s21c1
Sequence:CCGGGCCTGGACTCTCCTCAGTTCTCTCGAGAGAACTGAGGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-159s21c1
Sequence:CCGGGCGCTGCTCAATGGCGAGTATCTCGAGATACTCGCCATTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-1395s1c1
Sequence:CCGGGCCTGGACTCTCCTCAGTTCTCTCGAGAGAACTGAGGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-139s1c1
Sequence:CCGGGCGCTGCTCAATGGCGAGTATCTCGAGATACTCGCCATTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-596s1c1
Sequence:CCGGCGGTGAAGCTATGGGAGGTCTCTCGAGAGACCTCCCATAGCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024100.2-179s1c1
Sequence:CCGGGCAAGAATTACATCAGCGCCTCTCGAGAGGCGCTGATGTAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-1245s1c1
Sequence:CCGGCAAGATCAATCGGGACCTGTTCTCGAGAACAGGTCCCGATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024100
VALIDATED
WDR18 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 18
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-280s21c1
Sequence:CCGGGTCTGACTGCATCACCCAATGCTCGAGCATTGGGTGATGCAGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024100.3-368s21c1
Sequence:CCGGGGTCATCCTGAGTCGACACTACTCGAGTAGTGTCGACTCAGGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024100.3-1265s21c1
Sequence:CCGGCAAGATCAATCGGGACCTGTTCTCGAGAACAGGTCCCGATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-1415s21c1
Sequence:CCGGGCCTGGACTCTCCTCAGTTCTCTCGAGAGAACTGAGGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024100.3-159s21c1
Sequence:CCGGGCGCTGCTCAATGGCGAGTATCTCGAGATACTCGCCATTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-1395s1c1
Sequence:CCGGGCCTGGACTCTCCTCAGTTCTCTCGAGAGAACTGAGGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-139s1c1
Sequence:CCGGGCGCTGCTCAATGGCGAGTATCTCGAGATACTCGCCATTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-596s1c1
Sequence:CCGGCGGTGAAGCTATGGGAGGTCTCTCGAGAGACCTCCCATAGCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024100.2-179s1c1
Sequence:CCGGGCAAGAATTACATCAGCGCCTCTCGAGAGGCGCTGATGTAATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024100.2-1245s1c1
Sequence:CCGGCAAGATCAATCGGGACCTGTTCTCGAGAACAGGTCCCGATTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175450
WDR18 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 18
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175450.2-455s1c1
Sequence:CCGGGTCCGTTAGAGGTCATGCTTTCTCGAGAAAGCATGACCTCTAACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175450.2-483s1c1
Sequence:CCGGCATGGCAGATCAGAGATCTTGCTCGAGCAAGATCTCTGATCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-819s1c1
Sequence:CCGGCTCACATAGTTTGTCTTGTATCTCGAGATACAAGACAAACTATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-810s1c1
Sequence:CCGGGTTCTGATACTCACATAGTTTCTCGAGAAACTATGTGAGTATCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175450.2-367s1c1
Sequence:CCGGCGTGCTCAGATGAAGATCGATCTCGAGATCGATCTTCATCTGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-1097s1c1
Sequence:CCGGCCATGTCTATAGGGTCCTCATCTCGAGATGAGGACCCTATAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-805s1c1
Sequence:CCGGCCTCCGTTCTGATACTCACATCTCGAGATGTGAGTATCAGAACGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175450
WDR18 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 18
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175450.2-455s1c1
Sequence:CCGGGTCCGTTAGAGGTCATGCTTTCTCGAGAAAGCATGACCTCTAACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175450.2-483s1c1
Sequence:CCGGCATGGCAGATCAGAGATCTTGCTCGAGCAAGATCTCTGATCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-819s1c1
Sequence:CCGGCTCACATAGTTTGTCTTGTATCTCGAGATACAAGACAAACTATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-810s1c1
Sequence:CCGGGTTCTGATACTCACATAGTTTCTCGAGAAACTATGTGAGTATCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175450.2-367s1c1
Sequence:CCGGCGTGCTCAGATGAAGATCGATCTCGAGATCGATCTTCATCTGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-1097s1c1
Sequence:CCGGCCATGTCTATAGGGTCCTCATCTCGAGATGAGGACCCTATAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-805s1c1
Sequence:CCGGCCTCCGTTCTGATACTCACATCTCGAGATGTGAGTATCAGAACGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175450
WDR18 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 18
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175450.2-455s1c1
Sequence:CCGGGTCCGTTAGAGGTCATGCTTTCTCGAGAAAGCATGACCTCTAACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175450.2-483s1c1
Sequence:CCGGCATGGCAGATCAGAGATCTTGCTCGAGCAAGATCTCTGATCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-819s1c1
Sequence:CCGGCTCACATAGTTTGTCTTGTATCTCGAGATACAAGACAAACTATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-810s1c1
Sequence:CCGGGTTCTGATACTCACATAGTTTCTCGAGAAACTATGTGAGTATCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175450.2-367s1c1
Sequence:CCGGCGTGCTCAGATGAAGATCGATCTCGAGATCGATCTTCATCTGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-1097s1c1
Sequence:CCGGCCATGTCTATAGGGTCCTCATCTCGAGATGAGGACCCTATAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175450.2-805s1c1
Sequence:CCGGCCTCCGTTCTGATACTCACATCTCGAGATGTGAGTATCAGAACGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks