EMAIL THIS PAGE TO A FRIEND

WDR19

WD repeat domain 19

Synonyms: ATD5 CED4 DYF-2 IFT144 NPHP13 ORF26 Oseg6 PWDMP
UniProtKB ID: Q8NEZ3, B5MEF2, Q8N5B4, Q9H5S0, Q9HCD4
Gene ID:
Human(57728) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains six WD repeats, a clathrin heavy-chain repeat, and three transmembrane domains. This gene is conserved from C. elegans to human. It may participate in androgen-regulated signaling mechanisms or in the vesicular trafficking of androgen-regulated secretory processes. Alternatively spliced transcript variants encoding distinct isoforms have been reported but the full-length nature of one of these variants has not been defined. [provided by RefSeq, Jul 2008]
Mouse(213081) WD repeat domain 19
Rat(305349) WD repeat domain 19
naked mole-rat(101720180) WD repeat domain 19
domestic guinea pig(100733702) WD repeat domain 19
cow(533633) WD repeat domain 19
sheep(101113150) WD repeat domain 19
Zebrafish(556414) WD repeat domain 19
Horse(100055207) WD repeat domain 19
domestic cat(101084624) WD repeat domain 19
chicken(430829) WD repeat domain 19
dog(479113) WD repeat domain 19
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025132 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025132 Rosetta Predictions human pricing
XM_001078220 Rosetta Predictions rat pricing
XM_223412 Rosetta Predictions rat pricing
NM_153391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028056 predicted 2879
2 SASI_Hs01_00028057 predicted 1625
3 SASI_Hs01_00028058 predicted 3039
4 SASI_Hs01_00028059 predicted 3870
5 SASI_Hs01_00028061 predicted 3160
6 SASI_Hs01_00028062 predicted 4051
7 SASI_Hs02_00357842 predicted 2098
8 SASI_Hs01_00028064 predicted 1721
9 SASI_Hs02_00357843 predicted 2239
10 SASI_Hs01_00028065 predicted 1319
11 SASI_Hs01_00028060 predicted 4083
12 SASI_Hs01_00028063 predicted 3322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359997 predicted 694
2 SASI_Rn02_00359998 predicted 960
3 SASI_Rn02_00359999 predicted 458
4 SASI_Rn02_00360000 predicted 1448
5 SASI_Rn02_00360001 predicted 849
6 SASI_Rn02_00360002 predicted 3474
7 SASI_Rn02_00360003 predicted 1544
8 SASI_Rn02_00360004 predicted 1352
9 SASI_Rn02_00360005 predicted 2723
10 SASI_Rn02_00360006 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182708 predicted 690
2 SASI_Rn02_00381355 predicted 963
3 SASI_Rn02_00381356 predicted 461
4 SASI_Rn01_00182710 predicted 1450
5 SASI_Rn01_00182711 predicted 854
6 SASI_Rn01_00182713 predicted 3481
7 SASI_Rn01_00182714 predicted 1538
8 SASI_Rn01_00182715 predicted 1352
9 SASI_Rn01_00182716 predicted 2723
10 SASI_Rn01_00182717 predicted 736
11 SASI_Rn01_00182709 predicted 3071
12 SASI_Rn01_00182712 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343165 predicted 226
2 SASI_Mm01_00099000 predicted 757
3 SASI_Mm01_00099002 predicted 3148
4 SASI_Mm01_00099003 predicted 1470
5 SASI_Mm01_00099004 predicted 873
6 SASI_Mm01_00099005 predicted 2509
7 SASI_Mm01_00099006 predicted 1993
8 SASI_Mm02_00343166 predicted 3693
9 SASI_Mm02_00343167 predicted 2737
10 SASI_Mm01_00099007 predicted 3210
11 SASI_Mm01_00098998 predicted 4039
12 SASI_Mm01_00098999 predicted 678
13 SASI_Mm01_00099001 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153391
WDR19 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 19
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181991    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153391.1-4343s1c1
Sequence:CCGGCCTCTTCAAAGTCCTGTGTGTCTCGAGACACACAGGACTTTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153391.1-3272s1c1
Sequence:CCGGGCTCAGAAGATAATGTGGCAACTCGAGTTGCCACATTATCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153391.1-2255s1c1
Sequence:CCGGCGTTGGAACAAATAAAGGGAACTCGAGTTCCCTTTATTTGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153391.2-4171s21c1
Sequence:CCGGATTCTCCTTGGAGTCAGAAACCTCGAGGTTTCTGACTCCAAGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-1716s21c1
Sequence:CCGGGACTTCTCACCAACCATTAAACTCGAGTTTAATGGTTGGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-1538s21c1
Sequence:CCGGTACTGGCATCATTCACTATTTCTCGAGAAATAGTGAATGATGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-2413s21c1
Sequence:CCGGTGGAGTTCACAGGCGATTATGCTCGAGCATAATCGCCTGTGAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-3338s21c1
Sequence:CCGGCCGCTTGTACATGGCGCTAAACTCGAGTTTAGCGCCATGTACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153391
WDR19 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 19
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181991    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153391.1-4343s1c1
Sequence:CCGGCCTCTTCAAAGTCCTGTGTGTCTCGAGACACACAGGACTTTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153391.1-3272s1c1
Sequence:CCGGGCTCAGAAGATAATGTGGCAACTCGAGTTGCCACATTATCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153391.1-2255s1c1
Sequence:CCGGCGTTGGAACAAATAAAGGGAACTCGAGTTCCCTTTATTTGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153391.2-4171s21c1
Sequence:CCGGATTCTCCTTGGAGTCAGAAACCTCGAGGTTTCTGACTCCAAGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-1716s21c1
Sequence:CCGGGACTTCTCACCAACCATTAAACTCGAGTTTAATGGTTGGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-1538s21c1
Sequence:CCGGTACTGGCATCATTCACTATTTCTCGAGAAATAGTGAATGATGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-2413s21c1
Sequence:CCGGTGGAGTTCACAGGCGATTATGCTCGAGCATAATCGCCTGTGAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-3338s21c1
Sequence:CCGGCCGCTTGTACATGGCGCTAAACTCGAGTTTAGCGCCATGTACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153391
WDR19 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 19
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181991    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153391.1-4343s1c1
Sequence:CCGGCCTCTTCAAAGTCCTGTGTGTCTCGAGACACACAGGACTTTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153391.1-3272s1c1
Sequence:CCGGGCTCAGAAGATAATGTGGCAACTCGAGTTGCCACATTATCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153391.1-2255s1c1
Sequence:CCGGCGTTGGAACAAATAAAGGGAACTCGAGTTCCCTTTATTTGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153391.2-4171s21c1
Sequence:CCGGATTCTCCTTGGAGTCAGAAACCTCGAGGTTTCTGACTCCAAGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-1716s21c1
Sequence:CCGGGACTTCTCACCAACCATTAAACTCGAGTTTAATGGTTGGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-1538s21c1
Sequence:CCGGTACTGGCATCATTCACTATTTCTCGAGAAATAGTGAATGATGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-2413s21c1
Sequence:CCGGTGGAGTTCACAGGCGATTATGCTCGAGCATAATCGCCTGTGAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153391.2-3338s21c1
Sequence:CCGGCCGCTTGTACATGGCGCTAAACTCGAGTTTAGCGCCATGTACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025132
VALIDATED
WDR19 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 19
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-3297s1c1
Sequence:CCGGGCTCGGAAGATAATGTGGCAACTCGAGTTGCCACATTATCTTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_025132.2-3269s1c1
Sequence:CCGGGCACTTAAACACTTCCTGAAACTCGAGTTTCAGGAAGTGTTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-476s1c1
Sequence:CCGGGTTGGAAGTTTCCTGGCTGTTCTCGAGAACAGCCAGGAAACTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025132.2-2517s1c1
Sequence:CCGGCGGGTGATTATGTAAATGCTTCTCGAGAAGCATTTACATAATCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-335s1c1
Sequence:CCGGGATTGGGATAAAGATGGAGATCTCGAGATCTCCATCTTTATCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025132.3-4310s21c1
Sequence:CCGGAGGTCGGCACTTTCCACTTCTCTCGAGAGAAGTGGAAAGTGCCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025132.3-2684s21c1
Sequence:CCGGAGAGACTGTGGAGCCATATTGCTCGAGCAATATGGCTCCACAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025132.3-849s21c1
Sequence:CCGGGCAACATTGTCTGCTATAATTCTCGAGAATTATAGCAGACAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025132.3-4254s21c1
Sequence:CCGGGATTTAAGAGACGGTCCTTTCCTCGAGGAAAGGACCGTCTCTTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025132
VALIDATED
WDR19 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 19
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-3297s1c1
Sequence:CCGGGCTCGGAAGATAATGTGGCAACTCGAGTTGCCACATTATCTTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_025132.2-3269s1c1
Sequence:CCGGGCACTTAAACACTTCCTGAAACTCGAGTTTCAGGAAGTGTTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-476s1c1
Sequence:CCGGGTTGGAAGTTTCCTGGCTGTTCTCGAGAACAGCCAGGAAACTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025132.2-2517s1c1
Sequence:CCGGCGGGTGATTATGTAAATGCTTCTCGAGAAGCATTTACATAATCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-335s1c1
Sequence:CCGGGATTGGGATAAAGATGGAGATCTCGAGATCTCCATCTTTATCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025132.3-4310s21c1
Sequence:CCGGAGGTCGGCACTTTCCACTTCTCTCGAGAGAAGTGGAAAGTGCCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025132.3-2684s21c1
Sequence:CCGGAGAGACTGTGGAGCCATATTGCTCGAGCAATATGGCTCCACAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025132.3-849s21c1
Sequence:CCGGGCAACATTGTCTGCTATAATTCTCGAGAATTATAGCAGACAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025132.3-4254s21c1
Sequence:CCGGGATTTAAGAGACGGTCCTTTCCTCGAGGAAAGGACCGTCTCTTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025132
VALIDATED
WDR19 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 19
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-3297s1c1
Sequence:CCGGGCTCGGAAGATAATGTGGCAACTCGAGTTGCCACATTATCTTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_025132.2-3269s1c1
Sequence:CCGGGCACTTAAACACTTCCTGAAACTCGAGTTTCAGGAAGTGTTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-476s1c1
Sequence:CCGGGTTGGAAGTTTCCTGGCTGTTCTCGAGAACAGCCAGGAAACTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025132.2-2517s1c1
Sequence:CCGGCGGGTGATTATGTAAATGCTTCTCGAGAAGCATTTACATAATCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025132.2-335s1c1
Sequence:CCGGGATTGGGATAAAGATGGAGATCTCGAGATCTCCATCTTTATCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025132.3-4310s21c1
Sequence:CCGGAGGTCGGCACTTTCCACTTCTCTCGAGAGAAGTGGAAAGTGCCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025132.3-2684s21c1
Sequence:CCGGAGAGACTGTGGAGCCATATTGCTCGAGCAATATGGCTCCACAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025132.3-849s21c1
Sequence:CCGGGCAACATTGTCTGCTATAATTCTCGAGAATTATAGCAGACAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025132.3-4254s21c1
Sequence:CCGGGATTTAAGAGACGGTCCTTTCCTCGAGGAAAGGACCGTCTCTTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks