EMAIL THIS PAGE TO A FRIEND

WDR1

WD repeat domain 1

Synonyms: AIP1 NORI-1
Gene ID:
Human(9948) Summary: This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(22388) WD repeat domain 1
Rat(360950) WD repeat domain 1
Zebrafish(394014) WD repeat domain 1
domestic cat(101091531) WD repeat domain 1
dog(611070) WD repeat domain 1
chicken(422842) WD repeat domain 1
cow(533223) WD repeat domain 1
sheep(101115033) WD repeat domain 1
domestic guinea pig(100379233) WD repeat domain 1
naked mole-rat(101701711) WD repeat domain 1
Domestic Rabbit(100342944) WD repeat domain 1
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005112 Rosetta Predictions human pricing
NM_017491 Rosetta Predictions human pricing
NM_001014135 Rosetta Predictions rat pricing
NM_011715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339003 predicted 1137
2 SASI_Hs01_00162240 predicted 1496
3 SASI_Hs01_00162241 predicted 1712
4 SASI_Hs01_00162242 predicted 1518
5 SASI_Hs01_00162243 predicted 1937
6 SASI_Hs01_00162244 predicted 1838
7 SASI_Hs02_00339004 predicted 1738
8 SASI_Hs01_00162245 predicted 802
9 SASI_Hs01_00162247 predicted 1718
10 SASI_Hs01_00162248 predicted 889
11 SASI_Hs01_00162246 predicted 1873
12 SASI_Hs01_00162249 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350098 predicted 1553
2 SASI_Hs01_00077328 predicted 1910
3 SASI_Hs01_00077329 predicted 2126
4 SASI_Hs01_00077330 predicted 1933
5 SASI_Hs01_00077331 predicted 2360
6 SASI_Hs01_00077332 predicted 2254
7 SASI_Hs02_00350099 predicted 2155
8 SASI_Hs01_00077333 predicted 1217
9 SASI_Hs01_00077335 predicted 2141
10 SASI_Hs01_00077336 predicted 1306
11 SASI_Hs01_00077334 predicted 2284
12 SASI_Hs01_00077337 predicted 2336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098588 predicted 1283
2 SASI_Rn01_00098589 predicted 1848
3 SASI_Rn01_00098590 predicted 266
4 SASI_Rn01_00098591 predicted 1075
5 SASI_Rn01_00098592 predicted 1643
6 SASI_Rn01_00098594 predicted 326
7 SASI_Rn01_00098595 predicted 250
8 SASI_Rn02_00201593 predicted 1012
9 SASI_Rn01_00098596 predicted 950
10 SASI_Rn01_00098597 predicted 1566
11 SASI_Rn01_00098593 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321282 predicted 1902
2 SASI_Mm01_00169635 predicted 1342
3 SASI_Mm01_00169636 predicted 754
4 SASI_Mm01_00169637 predicted 1694
5 SASI_Mm01_00169638 predicted 1120
6 SASI_Mm02_00321283 predicted 307
7 SASI_Mm01_00169642 predicted 1062
8 SASI_Mm01_00169643 predicted 1597
9 SASI_Mm01_00169644 predicted 1626
10 SASI_Mm02_00321284 predicted 232
11 SASI_Mm01_00169639 predicted 1117
12 SASI_Mm01_00169640 predicted 1531
13 SASI_Mm01_00169641 predicted 1184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005112
WDR1 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005112.4-1713s21c1
Sequence:CCGGCGAATCAGGGACTAGAGTTTACTCGAGTAAACTCTAGTCCCTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005112.4-886s21c1
Sequence:CCGGCCACGACGGACACATTAATTACTCGAGTAATTAATGTGTCCGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-506s1c1
Sequence:CCGGGCTGGGAAGATCAAAGACATTCTCGAGAATGTCTTTGATCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-939s1c1
Sequence:CCGGGCACCCATTTGCTTTCTGCTTCTCGAGAAGCAGAAAGCAAATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-277s1c1
Sequence:CCGGCGACCCTAAGGGCAACAATTTCTCGAGAAATTGTTGCCCTTAGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-349s1c1
Sequence:CCGGCCTTGCTGACATCTACACAGACTCGAGTCTGTGTAGATGTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-906s1c1
Sequence:CCGGGTGGGATTTACGCAATTAGTTCTCGAGAACTAATTGCGTAAATCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005112
WDR1 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005112.4-1713s21c1
Sequence:CCGGCGAATCAGGGACTAGAGTTTACTCGAGTAAACTCTAGTCCCTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005112.4-886s21c1
Sequence:CCGGCCACGACGGACACATTAATTACTCGAGTAATTAATGTGTCCGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-506s1c1
Sequence:CCGGGCTGGGAAGATCAAAGACATTCTCGAGAATGTCTTTGATCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-939s1c1
Sequence:CCGGGCACCCATTTGCTTTCTGCTTCTCGAGAAGCAGAAAGCAAATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-277s1c1
Sequence:CCGGCGACCCTAAGGGCAACAATTTCTCGAGAAATTGTTGCCCTTAGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-349s1c1
Sequence:CCGGCCTTGCTGACATCTACACAGACTCGAGTCTGTGTAGATGTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-906s1c1
Sequence:CCGGGTGGGATTTACGCAATTAGTTCTCGAGAACTAATTGCGTAAATCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005112
WDR1 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005112.4-1713s21c1
Sequence:CCGGCGAATCAGGGACTAGAGTTTACTCGAGTAAACTCTAGTCCCTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005112.4-886s21c1
Sequence:CCGGCCACGACGGACACATTAATTACTCGAGTAATTAATGTGTCCGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-506s1c1
Sequence:CCGGGCTGGGAAGATCAAAGACATTCTCGAGAATGTCTTTGATCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-939s1c1
Sequence:CCGGGCACCCATTTGCTTTCTGCTTCTCGAGAAGCAGAAAGCAAATGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-277s1c1
Sequence:CCGGCGACCCTAAGGGCAACAATTTCTCGAGAAATTGTTGCCCTTAGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-349s1c1
Sequence:CCGGCCTTGCTGACATCTACACAGACTCGAGTCTGTGTAGATGTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005112.3-906s1c1
Sequence:CCGGGTGGGATTTACGCAATTAGTTCTCGAGAACTAATTGCGTAAATCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011715
VALIDATED
WDR1 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1619s21c1
Sequence:CCGGGCTGATGGCTATTCGGAGAATCTCGAGATTCTCCGAATAGCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1086s21c1
Sequence:CCGGGCCATGATGGACATATCAATTCTCGAGAATTGATATGTCCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-368s21c1
Sequence:CCGGGCTGGGAAGATCAAGGACATTCTCGAGAATGTCCTTGATCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1940s21c1
Sequence:CCGGGCACCCTTCTCTTAACTATTTCTCGAGAAATAGTTAAGAGAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-184s21c1
Sequence:CCGGCATCCTAAGAAACATCGATAACTCGAGTTATCGATGTTTCTTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1086s1c1
Sequence:CCGGGCCATGATGGACATATCAATTCTCGAGAATTGATATGTCCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1619s1c1
Sequence:CCGGGCTGATGGCTATTCGGAGAATCTCGAGATTCTCCGAATAGCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1622s1c1
Sequence:CCGGGATGGCTATTCGGAGAATAATCTCGAGATTATTCTCCGAATAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-368s1c1
Sequence:CCGGGCTGGGAAGATCAAGGACATTCTCGAGAATGTCCTTGATCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011715
VALIDATED
WDR1 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1619s21c1
Sequence:CCGGGCTGATGGCTATTCGGAGAATCTCGAGATTCTCCGAATAGCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1086s21c1
Sequence:CCGGGCCATGATGGACATATCAATTCTCGAGAATTGATATGTCCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-368s21c1
Sequence:CCGGGCTGGGAAGATCAAGGACATTCTCGAGAATGTCCTTGATCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1940s21c1
Sequence:CCGGGCACCCTTCTCTTAACTATTTCTCGAGAAATAGTTAAGAGAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-184s21c1
Sequence:CCGGCATCCTAAGAAACATCGATAACTCGAGTTATCGATGTTTCTTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1086s1c1
Sequence:CCGGGCCATGATGGACATATCAATTCTCGAGAATTGATATGTCCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1619s1c1
Sequence:CCGGGCTGATGGCTATTCGGAGAATCTCGAGATTCTCCGAATAGCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1622s1c1
Sequence:CCGGGATGGCTATTCGGAGAATAATCTCGAGATTATTCTCCGAATAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-368s1c1
Sequence:CCGGGCTGGGAAGATCAAGGACATTCTCGAGAATGTCCTTGATCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011715
VALIDATED
WDR1 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1619s21c1
Sequence:CCGGGCTGATGGCTATTCGGAGAATCTCGAGATTCTCCGAATAGCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1086s21c1
Sequence:CCGGGCCATGATGGACATATCAATTCTCGAGAATTGATATGTCCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-368s21c1
Sequence:CCGGGCTGGGAAGATCAAGGACATTCTCGAGAATGTCCTTGATCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-1940s21c1
Sequence:CCGGGCACCCTTCTCTTAACTATTTCTCGAGAAATAGTTAAGAGAAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011715.2-184s21c1
Sequence:CCGGCATCCTAAGAAACATCGATAACTCGAGTTATCGATGTTTCTTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1086s1c1
Sequence:CCGGGCCATGATGGACATATCAATTCTCGAGAATTGATATGTCCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1619s1c1
Sequence:CCGGGCTGATGGCTATTCGGAGAATCTCGAGATTCTCCGAATAGCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-1622s1c1
Sequence:CCGGGATGGCTATTCGGAGAATAATCTCGAGATTATTCTCCGAATAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011715.1-368s1c1
Sequence:CCGGGCTGGGAAGATCAAGGACATTCTCGAGAATGTCCTTGATCTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks