EMAIL THIS PAGE TO A FRIEND

WDR20

WD repeat domain 20

Synonyms: DMR
Gene ID:
Human(91833) Summary: This gene encodes a WD repeat-containing protein that functions to preserve and regulate the activity of the USP12-UAF1 deubiquitinating enzyme complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Rat(314453) WD repeat domain 20
Zebrafish(100535470) WD repeat domain 20
chicken(423464) WD repeat domain 20
dog(611234) WD repeat domain 20
Horse(100055061) WD repeat domain 20
domestic cat(101095106) WD repeat domain 20
cow(516477) WD repeat domain 20
sheep(101102936) WD repeat domain 20
domestic guinea pig(100733652) WD repeat domain 20
Domestic Rabbit(100337850) WD repeat domain 20
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144574 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144574 Rosetta Predictions human pricing
NM_181291 Rosetta Predictions human pricing
NM_181302 Rosetta Predictions human pricing
NM_181308 Rosetta Predictions human pricing
XM_001071278 Rosetta Predictions rat pricing
XM_234540 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078690 predicted 1466
2 SASI_Hs01_00078691 predicted 981
3 SASI_Hs01_00078692 predicted 1485
4 SASI_Hs01_00078693 predicted 1130
5 SASI_Hs01_00078694 predicted 983
6 SASI_Hs01_00078695 predicted 1042
7 SASI_Hs01_00078696 predicted 1484
8 SASI_Hs01_00078697 predicted 1192
9 SASI_Hs01_00078698 predicted 1421
10 SASI_Hs01_00078699 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043440 predicted 1462
2 SASI_Hs01_00043441 predicted 977
3 SASI_Hs01_00043442 predicted 1481
4 SASI_Hs01_00043443 predicted 1126
5 SASI_Hs01_00043444 predicted 980
6 SASI_Hs01_00043445 predicted 1045
7 SASI_Hs01_00043446 predicted 1489
8 SASI_Hs01_00043447 predicted 1194
9 SASI_Hs01_00043448 predicted 1420
10 SASI_Hs01_00043449 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142461 predicted 1292
2 SASI_Hs01_00142462 predicted 811
3 SASI_Hs01_00142463 predicted 1317
4 SASI_Hs01_00142464 predicted 963
5 SASI_Hs01_00142465 predicted 816
6 SASI_Hs01_00142466 predicted 868
7 SASI_Hs01_00142467 predicted 1318
8 SASI_Hs01_00142468 predicted 1023
9 SASI_Hs01_00142469 predicted 1252
10 SASI_Hs01_00142470 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236081 predicted 1278
2 SASI_Hs01_00236082 predicted 798
3 SASI_Hs01_00236083 predicted 1300
4 SASI_Hs01_00236084 predicted 947
5 SASI_Hs01_00236085 predicted 800
6 SASI_Hs01_00236086 predicted 857
7 SASI_Hs01_00236087 predicted 1301
8 SASI_Hs01_00236088 predicted 1009
9 SASI_Hs01_00236089 predicted 1233
10 SASI_Hs01_00236090 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334470 predicted 1542
2 SASI_Rn02_00334471 predicted 1063
3 SASI_Rn02_00334472 predicted 1773
4 SASI_Rn02_00334473 predicted 1602
5 SASI_Rn02_00334474 predicted 1405
6 SASI_Rn02_00334475 predicted 1258
7 SASI_Rn02_00334476 predicted 1686
8 SASI_Rn02_00334477 predicted 623
9 SASI_Rn02_00334478 predicted 1505
10 SASI_Rn02_00334479 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388549 predicted 1551
2 SASI_Rn02_00388550 predicted 1069
3 SASI_Rn02_00388551 predicted 1772
4 SASI_Rn02_00388552 predicted 1603
5 SASI_Rn02_00388553 predicted 1411
6 SASI_Rn02_00388554 predicted 1265
7 SASI_Rn02_00388555 predicted 1685
8 SASI_Rn02_00388556 predicted 622
9 SASI_Rn02_00388557 predicted 1504
10 SASI_Rn02_00388558 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144574
WDR20 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1140s1c1
Sequence:CCGGGTGTCACGTATCGGTTTGGTTCTCGAGAACCAAACCGATACGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-1135s1c1
Sequence:CCGGCGTAAGTGTCACGTATCGGTTCTCGAGAACCGATACGTGACACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-496s1c1
Sequence:CCGGGTCACGAGTTACCTGTGTCAACTCGAGTTGACACAGGTAACTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1611s1c1
Sequence:CCGGCCTTGTTAGAGCCGCTGATATCTCGAGATATCAGCGGCTCTAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144574.2-2019s1c1
Sequence:CCGGGCGCTCCTGTATTAGACTATTCTCGAGAATAGTCTAATACAGGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-79s1c1
Sequence:CCGGGAACGAGATTAAGACCCAATTCTCGAGAATTGGGTCTTAATCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144574.2-1899s1c1
Sequence:CCGGGCATGCCATGTAATTCTGAATCTCGAGATTCAGAATTACATGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144574.2-2163s1c1
Sequence:CCGGCAATGTGTGTTCAGCACAGATCTCGAGATCTGTGCTGAACACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1471s1c1
Sequence:CCGGCGAGAAAGATCACAAGCGAAACTCGAGTTTCGCTTGTGATCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144574.2-1764s1c1
Sequence:CCGGGCACCAGATCTAGAACTTGAACTCGAGTTCAAGTTCTAGATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144574
WDR20 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1140s1c1
Sequence:CCGGGTGTCACGTATCGGTTTGGTTCTCGAGAACCAAACCGATACGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-1135s1c1
Sequence:CCGGCGTAAGTGTCACGTATCGGTTCTCGAGAACCGATACGTGACACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-496s1c1
Sequence:CCGGGTCACGAGTTACCTGTGTCAACTCGAGTTGACACAGGTAACTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1611s1c1
Sequence:CCGGCCTTGTTAGAGCCGCTGATATCTCGAGATATCAGCGGCTCTAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144574.2-2019s1c1
Sequence:CCGGGCGCTCCTGTATTAGACTATTCTCGAGAATAGTCTAATACAGGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-79s1c1
Sequence:CCGGGAACGAGATTAAGACCCAATTCTCGAGAATTGGGTCTTAATCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144574.2-1899s1c1
Sequence:CCGGGCATGCCATGTAATTCTGAATCTCGAGATTCAGAATTACATGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144574.2-2163s1c1
Sequence:CCGGCAATGTGTGTTCAGCACAGATCTCGAGATCTGTGCTGAACACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1471s1c1
Sequence:CCGGCGAGAAAGATCACAAGCGAAACTCGAGTTTCGCTTGTGATCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144574.2-1764s1c1
Sequence:CCGGGCACCAGATCTAGAACTTGAACTCGAGTTCAAGTTCTAGATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144574
WDR20 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1140s1c1
Sequence:CCGGGTGTCACGTATCGGTTTGGTTCTCGAGAACCAAACCGATACGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-1135s1c1
Sequence:CCGGCGTAAGTGTCACGTATCGGTTCTCGAGAACCGATACGTGACACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-496s1c1
Sequence:CCGGGTCACGAGTTACCTGTGTCAACTCGAGTTGACACAGGTAACTCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1611s1c1
Sequence:CCGGCCTTGTTAGAGCCGCTGATATCTCGAGATATCAGCGGCTCTAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137201    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144574.2-2019s1c1
Sequence:CCGGGCGCTCCTGTATTAGACTATTCTCGAGAATAGTCTAATACAGGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144574.2-79s1c1
Sequence:CCGGGAACGAGATTAAGACCCAATTCTCGAGAATTGGGTCTTAATCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144574.2-1899s1c1
Sequence:CCGGGCATGCCATGTAATTCTGAATCTCGAGATTCAGAATTACATGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144574.2-2163s1c1
Sequence:CCGGCAATGTGTGTTCAGCACAGATCTCGAGATCTGTGCTGAACACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144574.2-1471s1c1
Sequence:CCGGCGAGAAAGATCACAAGCGAAACTCGAGTTTCGCTTGTGATCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144574.2-1764s1c1
Sequence:CCGGGCACCAGATCTAGAACTTGAACTCGAGTTCAAGTTCTAGATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks