EMAIL THIS PAGE TO A FRIEND

WDR24

WD repeat domain 24

Synonyms: C16orf21 JFP7
UniProtKB ID: Q96S15, A2IDB8, D3DU59, Q96GC7, Q9H0B7
Gene ID:
Mouse(268933) WD repeat domain 24
Rat(360497) WD repeat domain 24
Zebrafish(406336) WD repeat domain 24
chicken(416406) WD repeat domain 24
dog(479891) WD repeat domain 24
domestic cat(101087801) WD repeat domain 24
Horse(100065239) WD repeat domain 24
cow(507528) WD repeat domain 24
sheep(101104116) WD repeat domain 24
Goat(100861347) WD repeat domain 24
naked mole-rat(101704001) WD repeat domain 24
domestic guinea pig(100717603) WD repeat domain 24
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032259 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099161 MISSION® esiRNA esiRNA human WDR24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032259 Rosetta Predictions human pricing
XM_001061380 Rosetta Predictions rat pricing
XM_001063483 Rosetta Predictions rat pricing
NM_173741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122968 predicted 1433
2 SASI_Hs01_00122970 predicted 2668
3 SASI_Hs01_00122971 predicted 1194
4 SASI_Hs01_00122973 predicted 2439
5 SASI_Hs01_00122974 predicted 2914
6 SASI_Hs01_00122975 predicted 2464
7 SASI_Hs02_00359566 predicted 2315
8 SASI_Hs01_00122976 predicted 2324
9 SASI_Hs01_00122977 predicted 755
10 SASI_Hs02_00359567 predicted 1308
11 SASI_Hs01_00122969 predicted 2210
12 SASI_Hs01_00122972 predicted 2111
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299856 predicted 2180
2 SASI_Rn02_00299857 predicted 975
3 SASI_Rn02_00299858 predicted 673
4 SASI_Rn02_00299859 predicted 1423
5 SASI_Rn02_00299860 predicted 2608
6 SASI_Rn02_00299861 predicted 2819
7 SASI_Rn02_00299862 predicted 672
8 SASI_Rn02_00299863 predicted 1265
9 SASI_Rn02_00299864 predicted 1639
10 SASI_Rn02_00299865 predicted 2774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307281 predicted 2171
2 SASI_Rn02_00307282 predicted 974
3 SASI_Rn02_00307283 predicted 672
4 SASI_Rn02_00307284 predicted 1425
5 SASI_Rn02_00307285 predicted 2605
6 SASI_Rn02_00307286 predicted 2820
7 SASI_Rn02_00307287 predicted 664
8 SASI_Rn02_00307288 predicted 1256
9 SASI_Rn02_00307289 predicted 1631
10 SASI_Rn02_00307290 predicted 2775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032253 predicted 575
2 SASI_Mm01_00032254 predicted 1263
3 SASI_Mm01_00032255 predicted 2061
4 SASI_Mm01_00032257 predicted 938
5 SASI_Mm01_00032258 predicted 1735
6 SASI_Mm02_00345386 predicted 2571
7 SASI_Mm01_00032259 predicted 2610
8 SASI_Mm01_00032260 predicted 2099
9 SASI_Mm01_00032261 predicted 639
10 SASI_Mm01_00032262 predicted 1729
11 SASI_Mm01_00032256 predicted 2094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173741
VALIDATED
WDR24 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 24
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-864s1c1
Sequence:CCGGCACAGTGAACAAAGTCTGTTTCTCGAGAAACAGACTTTGTTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-1848s1c1
Sequence:CCGGGACCATGTTACGGATTATCTACTCGAGTAGATAATCCGTAACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-635s1c1
Sequence:CCGGGCCGAAGCATCTTCAAGATTTCTCGAGAAATCTTGAAGATGCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-1738s21c1
Sequence:CCGGGTGGATACAGCTGAACGTTATCTCGAGATAACGTTCAGCTGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-2059s21c1
Sequence:CCGGCTCGTCACCAATGAGGATAATCTCGAGATTATCCTCATTGGTGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-1845s21c1
Sequence:CCGGATGGACCATGTTACGGATTATCTCGAGATAATCCGTAACATGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173741.2-2886s21c1
Sequence:CCGGCTAAGGCTGATGCAGCGTCCTCTCGAGAGGACGCTGCATCAGCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173741.2-2525s21c1
Sequence:CCGGACTGGTACACATCCTACATAGCTCGAGCTATGTAGGATGTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173741
VALIDATED
WDR24 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 24
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-864s1c1
Sequence:CCGGCACAGTGAACAAAGTCTGTTTCTCGAGAAACAGACTTTGTTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-1848s1c1
Sequence:CCGGGACCATGTTACGGATTATCTACTCGAGTAGATAATCCGTAACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-635s1c1
Sequence:CCGGGCCGAAGCATCTTCAAGATTTCTCGAGAAATCTTGAAGATGCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-1738s21c1
Sequence:CCGGGTGGATACAGCTGAACGTTATCTCGAGATAACGTTCAGCTGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-2059s21c1
Sequence:CCGGCTCGTCACCAATGAGGATAATCTCGAGATTATCCTCATTGGTGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-1845s21c1
Sequence:CCGGATGGACCATGTTACGGATTATCTCGAGATAATCCGTAACATGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173741.2-2886s21c1
Sequence:CCGGCTAAGGCTGATGCAGCGTCCTCTCGAGAGGACGCTGCATCAGCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173741.2-2525s21c1
Sequence:CCGGACTGGTACACATCCTACATAGCTCGAGCTATGTAGGATGTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173741
VALIDATED
WDR24 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 24
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-864s1c1
Sequence:CCGGCACAGTGAACAAAGTCTGTTTCTCGAGAAACAGACTTTGTTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-1848s1c1
Sequence:CCGGGACCATGTTACGGATTATCTACTCGAGTAGATAATCCGTAACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173741.2-635s1c1
Sequence:CCGGGCCGAAGCATCTTCAAGATTTCTCGAGAAATCTTGAAGATGCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-1738s21c1
Sequence:CCGGGTGGATACAGCTGAACGTTATCTCGAGATAACGTTCAGCTGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-2059s21c1
Sequence:CCGGCTCGTCACCAATGAGGATAATCTCGAGATTATCCTCATTGGTGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173741.2-1845s21c1
Sequence:CCGGATGGACCATGTTACGGATTATCTCGAGATAATCCGTAACATGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173741.2-2886s21c1
Sequence:CCGGCTAAGGCTGATGCAGCGTCCTCTCGAGAGGACGCTGCATCAGCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173741.2-2525s21c1
Sequence:CCGGACTGGTACACATCCTACATAGCTCGAGCTATGTAGGATGTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032259
WDR24 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 24
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-896s1c1
Sequence:CCGGCCGTAGCATCTTCAAGATCTACTCGAGTAGATCTTGAAGATGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1889s1c1
Sequence:CCGGCATCTTCTTTAAGCGCAAGCTCTCGAGAGCTTGCGCTTAAAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-2326s1c1
Sequence:CCGGCCAATGAGGATAACGAGGAAACTCGAGTTTCCTCGTTATCCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1190s1c1
Sequence:CCGGCTTCATGAAGTGCTTTGACCTCTCGAGAGGTCAAAGCACTTCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1586s1c1
Sequence:CCGGCCACAACATCTATGTTTGGGACTCGAGTCCCAAACATAGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032259.1-902s1c1
Sequence:CCGGCATCTTCAAGATCTATGCCATCTCGAGATGGCATAGATCTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-2108s21c1
Sequence:CCGGACCATGCTGCGGATCATCTACCTCGAGGTAGATGATCCGCAGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-1303s21c1
Sequence:CCGGCACCTTTGAGAACGGCAATGTCTCGAGACATTGCCGTTCTCAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-2045s21c1
Sequence:CCGGCTCTGTGACCACAACGCAAAGCTCGAGCTTTGCGTTGTGGTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032259
WDR24 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 24
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-896s1c1
Sequence:CCGGCCGTAGCATCTTCAAGATCTACTCGAGTAGATCTTGAAGATGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1889s1c1
Sequence:CCGGCATCTTCTTTAAGCGCAAGCTCTCGAGAGCTTGCGCTTAAAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-2326s1c1
Sequence:CCGGCCAATGAGGATAACGAGGAAACTCGAGTTTCCTCGTTATCCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1190s1c1
Sequence:CCGGCTTCATGAAGTGCTTTGACCTCTCGAGAGGTCAAAGCACTTCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1586s1c1
Sequence:CCGGCCACAACATCTATGTTTGGGACTCGAGTCCCAAACATAGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032259.1-902s1c1
Sequence:CCGGCATCTTCAAGATCTATGCCATCTCGAGATGGCATAGATCTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-2108s21c1
Sequence:CCGGACCATGCTGCGGATCATCTACCTCGAGGTAGATGATCCGCAGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-1303s21c1
Sequence:CCGGCACCTTTGAGAACGGCAATGTCTCGAGACATTGCCGTTCTCAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-2045s21c1
Sequence:CCGGCTCTGTGACCACAACGCAAAGCTCGAGCTTTGCGTTGTGGTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032259
WDR24 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 24
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-896s1c1
Sequence:CCGGCCGTAGCATCTTCAAGATCTACTCGAGTAGATCTTGAAGATGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1889s1c1
Sequence:CCGGCATCTTCTTTAAGCGCAAGCTCTCGAGAGCTTGCGCTTAAAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-2326s1c1
Sequence:CCGGCCAATGAGGATAACGAGGAAACTCGAGTTTCCTCGTTATCCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1190s1c1
Sequence:CCGGCTTCATGAAGTGCTTTGACCTCTCGAGAGGTCAAAGCACTTCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032259.1-1586s1c1
Sequence:CCGGCCACAACATCTATGTTTGGGACTCGAGTCCCAAACATAGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032259.1-902s1c1
Sequence:CCGGCATCTTCAAGATCTATGCCATCTCGAGATGGCATAGATCTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-2108s21c1
Sequence:CCGGACCATGCTGCGGATCATCTACCTCGAGGTAGATGATCCGCAGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-1303s21c1
Sequence:CCGGCACCTTTGAGAACGGCAATGTCTCGAGACATTGCCGTTCTCAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032259.2-2045s21c1
Sequence:CCGGCTCTGTGACCACAACGCAAAGCTCGAGCTTTGCGTTGTGGTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks