EMAIL THIS PAGE TO A FRIEND

WDR25

WD repeat domain 25

Synonyms: C14orf67
UniProtKB ID: Q64LD2, A8K7E5, Q6NVV6, Q86TQ4, Q9BTK5
Gene ID:
Mouse(212198) WD repeat domain 25
Rat(299317) WD repeat domain 25
domestic guinea pig(100718358) WD repeat domain 25
naked mole-rat(101702243) WD repeat domain 25
cow(527651) WD repeat domain 25
sheep(101119425) WD repeat domain 25
chicken(428908) WD repeat domain 25
Horse(100055415) WD repeat domain 25
domestic cat(101081309) WD repeat domain 25
dog(490858) WD repeat domain 25
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001474974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001474974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001474974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024515 Rosetta Predictions human pricing
XM_234568 Rosetta Predictions rat pricing
XM_001474974 Rosetta Predictions mouse pricing
XM_001476637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116885 predicted 1077
2 SASI_Hs01_00116886 predicted 297
3 SASI_Hs01_00116890 predicted 1314
4 SASI_Hs01_00116891 predicted 421
5 SASI_Hs02_00356788 predicted 1314
6 SASI_Hs01_00116892 predicted 212
7 SASI_Hs01_00116893 predicted 1052
8 SASI_Hs01_00116894 predicted 641
9 SASI_Hs02_00356789 predicted 1081
10 SASI_Hs02_00356790 predicted 1595
11 SASI_Hs01_00116887 predicted 1174
12 SASI_Hs01_00116888 predicted 1122
13 SASI_Hs01_00116889 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388579 predicted 599
2 SASI_Rn02_00388580 predicted 709
3 SASI_Rn02_00388581 predicted 913
4 SASI_Rn02_00388582 predicted 662
5 SASI_Rn02_00388583 predicted 754
6 SASI_Rn02_00388584 predicted 1092
7 SASI_Rn02_00388585 predicted 1060
8 SASI_Rn02_00388586 predicted 207
9 SASI_Rn02_00388587 predicted 1171
10 SASI_Rn02_00388588 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00379226 predicted 859
2 SASI_Mm02_00379227 predicted 508
3 SASI_Mm02_00379228 predicted 302
4 SASI_Mm02_00379229 predicted 1259
5 SASI_Mm02_00379230 predicted 401
6 SASI_Mm02_00379231 predicted 669
7 SASI_Mm02_00379232 predicted 1009
8 SASI_Mm02_00379233 predicted 432
9 SASI_Mm02_00379234 predicted 428
10 SASI_Mm02_00379235 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00390310 predicted 964
2 SASI_Mm02_00390311 predicted 1345
3 SASI_Mm02_00390312 predicted 667
4 SASI_Mm02_00390313 predicted 432
5 SASI_Mm02_00390314 predicted 1336
6 SASI_Mm02_00390315 predicted 1402
7 SASI_Mm02_00390316 predicted 437
8 SASI_Mm02_00390317 predicted 1010
9 SASI_Mm02_00390318 predicted 1216
10 SASI_Mm02_00390319 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177602
WDR25 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 25
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1782s21c1
Sequence:CCGGGCGCAAGCGTGTGTTAGTAAACTCGAGTTTACTAACACACGCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1737s21c1
Sequence:CCGGGGCTTCAGTGACTCGGCTATACTCGAGTATAGCCGAGTCACTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177602.3-960s21c1
Sequence:CCGGTCAGTGGTGGCTTCGACTTTGCTCGAGCAAAGTCGAAGCCACCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1824s21c1
Sequence:CCGGGGGTGACACGCAATCAGTAAGCTCGAGCTTACTGATTGCGTGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177602.3-692s21c1
Sequence:CCGGGAGTTCATCCAGCCATATTTGCTCGAGCAAATATGGCTGGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177602.2-598s1c1
Sequence:CCGGGAGACATCAAGATCTGGCACTCTCGAGAGTGCCAGATCTTGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-245s1c1
Sequence:CCGGCCAGATCTTCCATGAGAGGTACTCGAGTACCTCTCATGGAAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177602.2-1163s1c1
Sequence:CCGGCCCACTATAAGACACCAACAACTCGAGTTGTTGGTGTCTTATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-148s1c1
Sequence:CCGGGCTCCGAGTTTCTTAGCAGTACTCGAGTACTGCTAAGAAACTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-199s1c1
Sequence:CCGGGAACCATTATCGCCTGGGATTCTCGAGAATCCCAGGCGATAATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-152s1c1
Sequence:CCGGCGAGTTTCTTAGCAGTACGGACTCGAGTCCGTACTGCTAAGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177602
WDR25 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 25
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1782s21c1
Sequence:CCGGGCGCAAGCGTGTGTTAGTAAACTCGAGTTTACTAACACACGCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1737s21c1
Sequence:CCGGGGCTTCAGTGACTCGGCTATACTCGAGTATAGCCGAGTCACTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177602.3-960s21c1
Sequence:CCGGTCAGTGGTGGCTTCGACTTTGCTCGAGCAAAGTCGAAGCCACCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1824s21c1
Sequence:CCGGGGGTGACACGCAATCAGTAAGCTCGAGCTTACTGATTGCGTGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177602.3-692s21c1
Sequence:CCGGGAGTTCATCCAGCCATATTTGCTCGAGCAAATATGGCTGGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177602.2-598s1c1
Sequence:CCGGGAGACATCAAGATCTGGCACTCTCGAGAGTGCCAGATCTTGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-245s1c1
Sequence:CCGGCCAGATCTTCCATGAGAGGTACTCGAGTACCTCTCATGGAAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177602.2-1163s1c1
Sequence:CCGGCCCACTATAAGACACCAACAACTCGAGTTGTTGGTGTCTTATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-148s1c1
Sequence:CCGGGCTCCGAGTTTCTTAGCAGTACTCGAGTACTGCTAAGAAACTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-199s1c1
Sequence:CCGGGAACCATTATCGCCTGGGATTCTCGAGAATCCCAGGCGATAATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-152s1c1
Sequence:CCGGCGAGTTTCTTAGCAGTACGGACTCGAGTCCGTACTGCTAAGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177602
WDR25 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 25
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1782s21c1
Sequence:CCGGGCGCAAGCGTGTGTTAGTAAACTCGAGTTTACTAACACACGCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1737s21c1
Sequence:CCGGGGCTTCAGTGACTCGGCTATACTCGAGTATAGCCGAGTCACTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177602.3-960s21c1
Sequence:CCGGTCAGTGGTGGCTTCGACTTTGCTCGAGCAAAGTCGAAGCCACCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177602.3-1824s21c1
Sequence:CCGGGGGTGACACGCAATCAGTAAGCTCGAGCTTACTGATTGCGTGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177602.3-692s21c1
Sequence:CCGGGAGTTCATCCAGCCATATTTGCTCGAGCAAATATGGCTGGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177602.2-598s1c1
Sequence:CCGGGAGACATCAAGATCTGGCACTCTCGAGAGTGCCAGATCTTGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-245s1c1
Sequence:CCGGCCAGATCTTCCATGAGAGGTACTCGAGTACCTCTCATGGAAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177602.2-1163s1c1
Sequence:CCGGCCCACTATAAGACACCAACAACTCGAGTTGTTGGTGTCTTATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-148s1c1
Sequence:CCGGGCTCCGAGTTTCTTAGCAGTACTCGAGTACTGCTAAGAAACTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-199s1c1
Sequence:CCGGGAACCATTATCGCCTGGGATTCTCGAGAATCCCAGGCGATAATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177602.2-152s1c1
Sequence:CCGGCGAGTTTCTTAGCAGTACGGACTCGAGTCCGTACTGCTAAGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024515
WDR25 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 25
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-789s21c1
Sequence:CCGGACGGAGACAGGCAAGGGTAAACTCGAGTTTACCCTTGCCTGTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-1225s21c1
Sequence:CCGGTTAGAATCACTACCTTGAAATCTCGAGATTTCAAGGTAGTGATTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-879s21c1
Sequence:CCGGGAGTTTATTCAGCCATATTTGCTCGAGCAAATATGGCTGAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-1188s21c1
Sequence:CCGGGAAACAGGAACCCAGCTATTTCTCGAGAAATAGCTGGGTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-1321s1c1
Sequence:CCGGGCACCATTATTGCCTGGGATTCTCGAGAATCCCAGGCAATAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-1174s1c1
Sequence:CCGGCTGAAATGAAAGCTTGGGATACTCGAGTATCCCAAGCTTTCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-430s1c1
Sequence:CCGGCCATCAAAGAGCCTTCTTGTTCTCGAGAACAAGAAGGCTCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024515.3-1792s1c1
Sequence:CCGGCTCTTCCTCAAGGGTAGATGACTCGAGTCATCTACCCTTGAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195919    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024515.3-1798s1c1
Sequence:CCGGCTCAAGGGTAGATGAGAGGAACTCGAGTTCCTCTCATCTACCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024515.3-1099s1c1
Sequence:CCGGGAAGTGACTTTAGAATCACTACTCGAGTAGTGATTCTAAAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-135s1c1
Sequence:CCGGGCTTCATTGGTAGCGTATGATCTCGAGATCATACGCTACCAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024515
WDR25 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 25
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-789s21c1
Sequence:CCGGACGGAGACAGGCAAGGGTAAACTCGAGTTTACCCTTGCCTGTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-1225s21c1
Sequence:CCGGTTAGAATCACTACCTTGAAATCTCGAGATTTCAAGGTAGTGATTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-879s21c1
Sequence:CCGGGAGTTTATTCAGCCATATTTGCTCGAGCAAATATGGCTGAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-1188s21c1
Sequence:CCGGGAAACAGGAACCCAGCTATTTCTCGAGAAATAGCTGGGTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-1321s1c1
Sequence:CCGGGCACCATTATTGCCTGGGATTCTCGAGAATCCCAGGCAATAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-1174s1c1
Sequence:CCGGCTGAAATGAAAGCTTGGGATACTCGAGTATCCCAAGCTTTCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-430s1c1
Sequence:CCGGCCATCAAAGAGCCTTCTTGTTCTCGAGAACAAGAAGGCTCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024515.3-1792s1c1
Sequence:CCGGCTCTTCCTCAAGGGTAGATGACTCGAGTCATCTACCCTTGAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195919    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024515.3-1798s1c1
Sequence:CCGGCTCAAGGGTAGATGAGAGGAACTCGAGTTCCTCTCATCTACCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024515.3-1099s1c1
Sequence:CCGGGAAGTGACTTTAGAATCACTACTCGAGTAGTGATTCTAAAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-135s1c1
Sequence:CCGGGCTTCATTGGTAGCGTATGATCTCGAGATCATACGCTACCAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024515
WDR25 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 25
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-789s21c1
Sequence:CCGGACGGAGACAGGCAAGGGTAAACTCGAGTTTACCCTTGCCTGTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-1225s21c1
Sequence:CCGGTTAGAATCACTACCTTGAAATCTCGAGATTTCAAGGTAGTGATTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-879s21c1
Sequence:CCGGGAGTTTATTCAGCCATATTTGCTCGAGCAAATATGGCTGAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024515.4-1188s21c1
Sequence:CCGGGAAACAGGAACCCAGCTATTTCTCGAGAAATAGCTGGGTTCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-1321s1c1
Sequence:CCGGGCACCATTATTGCCTGGGATTCTCGAGAATCCCAGGCAATAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-1174s1c1
Sequence:CCGGCTGAAATGAAAGCTTGGGATACTCGAGTATCCCAAGCTTTCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-430s1c1
Sequence:CCGGCCATCAAAGAGCCTTCTTGTTCTCGAGAACAAGAAGGCTCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024515.3-1792s1c1
Sequence:CCGGCTCTTCCTCAAGGGTAGATGACTCGAGTCATCTACCCTTGAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195919    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024515.3-1798s1c1
Sequence:CCGGCTCAAGGGTAGATGAGAGGAACTCGAGTTCCTCTCATCTACCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024515.3-1099s1c1
Sequence:CCGGGAAGTGACTTTAGAATCACTACTCGAGTAGTGATTCTAAAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024515.3-135s1c1
Sequence:CCGGGCTTCATTGGTAGCGTATGATCTCGAGATCATACGCTACCAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001474974
WDR25 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 25
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000215900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001474974.1-441s1c1
Sequence:CCGGCAAACCTTCTCATGATCAAAGCTCGAGCTTTGATCATGAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001474974
WDR25 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 25
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000215900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001474974.1-441s1c1
Sequence:CCGGCAAACCTTCTCATGATCAAAGCTCGAGCTTTGATCATGAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001474974
WDR25 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 25
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000215900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001474974.1-441s1c1
Sequence:CCGGCAAACCTTCTCATGATCAAAGCTCGAGCTTTGATCATGAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks