EMAIL THIS PAGE TO A FRIEND

WDR26

WD repeat domain 26

Synonyms: CDW2 GID7 MIP2
Gene ID:
Human(80232) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(226757) WD repeat domain 26
Rat(498301) WD repeat domain 26
domestic guinea pig(100734086) WD repeat domain 26
naked mole-rat(101705379) WD repeat domain 26
cow(767999) WD repeat domain 26
sheep(101109551) WD repeat domain 26
chicken(421324) WD repeat domain 26
Horse(100055826) WD repeat domain 26
domestic cat(101080503) WD repeat domain 26
dog(480115) WD repeat domain 26
256 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001115113 Rosetta Predictions human pricing
NM_025160 Rosetta Predictions human pricing
NM_001109081 Rosetta Predictions rat pricing
NM_145514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326946 predicted 1560
2 SASI_Hs02_00326947 predicted 1511
3 SASI_Hs02_00326948 predicted 917
4 SASI_Hs02_00326949 predicted 1845
5 SASI_Hs02_00326950 predicted 999
6 SASI_Hs02_00326951 predicted 1846
7 SASI_Hs02_00326952 predicted 961
8 SASI_Hs02_00326953 predicted 1414
9 SASI_Hs02_00326954 predicted 1370
10 SASI_Hs02_00326955 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029068 predicted 1612
2 SASI_Hs01_00029069 predicted 1556
3 SASI_Hs02_00357914 predicted 970
4 SASI_Hs01_00029070 predicted 1890
5 SASI_Hs01_00029071 predicted 1050
6 SASI_Hs02_00357915 predicted 1900
7 SASI_Hs01_00029072 predicted 1013
8 SASI_Hs01_00029073 predicted 1464
9 SASI_Hs02_00357916 predicted 1409
10 SASI_Hs01_00029074 predicted 1346
11 SASI_Hs01_00029075 predicted 460
12 SASI_Hs01_00029076 predicted 1054
13 SASI_Hs01_00029077 predicted 1870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244940 predicted 516
2 SASI_Rn02_00244941 predicted 1212
3 SASI_Rn02_00244942 predicted 709
4 SASI_Rn02_00244943 predicted 624
5 SASI_Rn02_00244944 predicted 1157
6 SASI_Rn02_00244945 predicted 1551
7 SASI_Rn02_00244946 predicted 291
8 SASI_Rn02_00244947 predicted 568
9 SASI_Rn02_00244948 predicted 356
10 SASI_Rn02_00244949 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025431 predicted 845
2 SASI_Mm02_00340982 predicted 1492
3 SASI_Mm01_00025433 predicted 1438
4 SASI_Mm01_00025434 predicted 1014
5 SASI_Mm01_00025435 predicted 833
6 SASI_Mm01_00025436 predicted 1006
7 SASI_Mm01_00025437 predicted 925
8 SASI_Mm02_00340983 predicted 1174
9 SASI_Mm01_00025438 predicted 1064
10 SASI_Mm01_00025439 predicted 594
11 SASI_Mm01_00025430 predicted 1512
12 SASI_Mm01_00025432 predicted 1721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145514
VALIDATED
WDR26 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 26
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1101s1c1
Sequence:CCGGGCCAATCTCATGAAGACAGTTCTCGAGAACTGTCTTCATGAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1916s1c1
Sequence:CCGGCCAAACATTTACACCTTGCTTCTCGAGAAGCAAGGTGTAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1343s1c1
Sequence:CCGGGTACAGGAAGATCATCCTATTCTCGAGAATAGGATGATCTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1397s1c1
Sequence:CCGGGCTTTGTTAAATGTAGCAACTCTCGAGAGTTGCTACATTTAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145514.2-2030s1c1
Sequence:CCGGGCTTACCCATTGAACTCAGTACTCGAGTACTGAGTTCAATGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145514.2-810s1c1
Sequence:CCGGGTTACACTCAACAGATACTTACTCGAGTAAGTATCTGTTGAGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145514.2-1933s1c1
Sequence:CCGGGCTTCCTAGTAACCAGTTGATCTCGAGATCAACTGGTTACTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145514.2-626s1c1
Sequence:CCGGGACAAGCTTCAGACCTATTTACTCGAGTAAATAGGTCTGAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-1507s21c1
Sequence:CCGGGCTTTGTTAAATGTAGCAACTCTCGAGAGTTGCTACATTTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-1086s21c1
Sequence:CCGGTGCGTATGGTGTCTCTTATATCTCGAGATATAAGAGACACCATACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145514.4-2339s21c1
Sequence:CCGGCCAAATCTTTCCGCCTTATTTCTCGAGAAATAAGGCGGAAAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-820s21c1
Sequence:CCGGCAAAGGGATCGGTGCCTATATCTCGAGATATAGGCACCGATCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-599s21c1
Sequence:CCGGGCGAACTGACGCCGTTGAAATCTCGAGATTTCAACGGCGTCAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145514
VALIDATED
WDR26 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 26
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1101s1c1
Sequence:CCGGGCCAATCTCATGAAGACAGTTCTCGAGAACTGTCTTCATGAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1916s1c1
Sequence:CCGGCCAAACATTTACACCTTGCTTCTCGAGAAGCAAGGTGTAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1343s1c1
Sequence:CCGGGTACAGGAAGATCATCCTATTCTCGAGAATAGGATGATCTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1397s1c1
Sequence:CCGGGCTTTGTTAAATGTAGCAACTCTCGAGAGTTGCTACATTTAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145514.2-2030s1c1
Sequence:CCGGGCTTACCCATTGAACTCAGTACTCGAGTACTGAGTTCAATGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145514.2-810s1c1
Sequence:CCGGGTTACACTCAACAGATACTTACTCGAGTAAGTATCTGTTGAGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145514.2-1933s1c1
Sequence:CCGGGCTTCCTAGTAACCAGTTGATCTCGAGATCAACTGGTTACTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145514.2-626s1c1
Sequence:CCGGGACAAGCTTCAGACCTATTTACTCGAGTAAATAGGTCTGAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-1507s21c1
Sequence:CCGGGCTTTGTTAAATGTAGCAACTCTCGAGAGTTGCTACATTTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-1086s21c1
Sequence:CCGGTGCGTATGGTGTCTCTTATATCTCGAGATATAAGAGACACCATACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145514.4-2339s21c1
Sequence:CCGGCCAAATCTTTCCGCCTTATTTCTCGAGAAATAAGGCGGAAAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-820s21c1
Sequence:CCGGCAAAGGGATCGGTGCCTATATCTCGAGATATAGGCACCGATCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-599s21c1
Sequence:CCGGGCGAACTGACGCCGTTGAAATCTCGAGATTTCAACGGCGTCAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145514
VALIDATED
WDR26 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 26
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1101s1c1
Sequence:CCGGGCCAATCTCATGAAGACAGTTCTCGAGAACTGTCTTCATGAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1916s1c1
Sequence:CCGGCCAAACATTTACACCTTGCTTCTCGAGAAGCAAGGTGTAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1343s1c1
Sequence:CCGGGTACAGGAAGATCATCCTATTCTCGAGAATAGGATGATCTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145514.2-1397s1c1
Sequence:CCGGGCTTTGTTAAATGTAGCAACTCTCGAGAGTTGCTACATTTAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145514.2-2030s1c1
Sequence:CCGGGCTTACCCATTGAACTCAGTACTCGAGTACTGAGTTCAATGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145514.2-810s1c1
Sequence:CCGGGTTACACTCAACAGATACTTACTCGAGTAAGTATCTGTTGAGTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145514.2-1933s1c1
Sequence:CCGGGCTTCCTAGTAACCAGTTGATCTCGAGATCAACTGGTTACTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145514.2-626s1c1
Sequence:CCGGGACAAGCTTCAGACCTATTTACTCGAGTAAATAGGTCTGAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-1507s21c1
Sequence:CCGGGCTTTGTTAAATGTAGCAACTCTCGAGAGTTGCTACATTTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-1086s21c1
Sequence:CCGGTGCGTATGGTGTCTCTTATATCTCGAGATATAAGAGACACCATACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145514.4-2339s21c1
Sequence:CCGGCCAAATCTTTCCGCCTTATTTCTCGAGAAATAAGGCGGAAAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-820s21c1
Sequence:CCGGCAAAGGGATCGGTGCCTATATCTCGAGATATAGGCACCGATCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145514.4-599s21c1
Sequence:CCGGGCGAACTGACGCCGTTGAAATCTCGAGATTTCAACGGCGTCAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025160
VALIDATED
WDR26 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 26
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-201s1c1
Sequence:CCGGGTGCCTATATCACAATACCAACTCGAGTTGGTATTGTGATATAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-670s1c1
Sequence:CCGGCAGTGTGACTTAGATGGTAATCTCGAGATTACCATCTAAGTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-487s1c1
Sequence:CCGGCCAGATGACAACTATCTTGTTCTCGAGAACAAGATAGTTGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025160.3-356s1c1
Sequence:CCGGGCACTAAACTAGCAACAGGATCTCGAGATCCTGTTGCTAGTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-992s1c1
Sequence:CCGGGAGGCCATAATGAAGACTTCACTCGAGTGAAGTCTTCATTATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-1151s1c1
Sequence:CCGGCCTCAGATGATGGCACTGTTACTCGAGTAACAGTGCCATCATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-190s1c1
Sequence:CCGGCAAAGGGATCGGTGCCTATATCTCGAGATATAGGCACCGATCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-660s1c1
Sequence:CCGGGCAGTTCTATCAGTGTGACTTCTCGAGAAGTCACACTGATAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-1329s21c1
Sequence:CCGGGCAGTTCTATCAGTGTGACTTCTCGAGAAGTCACACTGATAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-2180s21c1
Sequence:CCGGACCCATTGAACTCAGTATATACTCGAGTATATACTGAGTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025160.5-1156s21c1
Sequence:CCGGCCAGATGACAACTATCTTGTTCTCGAGAACAAGATAGTTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-1820s21c1
Sequence:CCGGCCTCAGATGATGGCACTGTTACTCGAGTAACAGTGCCATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025160
VALIDATED
WDR26 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 26
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-201s1c1
Sequence:CCGGGTGCCTATATCACAATACCAACTCGAGTTGGTATTGTGATATAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-670s1c1
Sequence:CCGGCAGTGTGACTTAGATGGTAATCTCGAGATTACCATCTAAGTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-487s1c1
Sequence:CCGGCCAGATGACAACTATCTTGTTCTCGAGAACAAGATAGTTGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025160.3-356s1c1
Sequence:CCGGGCACTAAACTAGCAACAGGATCTCGAGATCCTGTTGCTAGTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-992s1c1
Sequence:CCGGGAGGCCATAATGAAGACTTCACTCGAGTGAAGTCTTCATTATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-1151s1c1
Sequence:CCGGCCTCAGATGATGGCACTGTTACTCGAGTAACAGTGCCATCATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-190s1c1
Sequence:CCGGCAAAGGGATCGGTGCCTATATCTCGAGATATAGGCACCGATCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-660s1c1
Sequence:CCGGGCAGTTCTATCAGTGTGACTTCTCGAGAAGTCACACTGATAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-1329s21c1
Sequence:CCGGGCAGTTCTATCAGTGTGACTTCTCGAGAAGTCACACTGATAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-2180s21c1
Sequence:CCGGACCCATTGAACTCAGTATATACTCGAGTATATACTGAGTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025160.5-1156s21c1
Sequence:CCGGCCAGATGACAACTATCTTGTTCTCGAGAACAAGATAGTTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-1820s21c1
Sequence:CCGGCCTCAGATGATGGCACTGTTACTCGAGTAACAGTGCCATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025160
VALIDATED
WDR26 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 26
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-201s1c1
Sequence:CCGGGTGCCTATATCACAATACCAACTCGAGTTGGTATTGTGATATAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-670s1c1
Sequence:CCGGCAGTGTGACTTAGATGGTAATCTCGAGATTACCATCTAAGTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-487s1c1
Sequence:CCGGCCAGATGACAACTATCTTGTTCTCGAGAACAAGATAGTTGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025160.3-356s1c1
Sequence:CCGGGCACTAAACTAGCAACAGGATCTCGAGATCCTGTTGCTAGTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-992s1c1
Sequence:CCGGGAGGCCATAATGAAGACTTCACTCGAGTGAAGTCTTCATTATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-1151s1c1
Sequence:CCGGCCTCAGATGATGGCACTGTTACTCGAGTAACAGTGCCATCATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025160.3-190s1c1
Sequence:CCGGCAAAGGGATCGGTGCCTATATCTCGAGATATAGGCACCGATCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025160.3-660s1c1
Sequence:CCGGGCAGTTCTATCAGTGTGACTTCTCGAGAAGTCACACTGATAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-1329s21c1
Sequence:CCGGGCAGTTCTATCAGTGTGACTTCTCGAGAAGTCACACTGATAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-2180s21c1
Sequence:CCGGACCCATTGAACTCAGTATATACTCGAGTATATACTGAGTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025160.5-1156s21c1
Sequence:CCGGCCAGATGACAACTATCTTGTTCTCGAGAACAAGATAGTTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_025160.5-1820s21c1
Sequence:CCGGCCTCAGATGATGGCACTGTTACTCGAGTAACAGTGCCATCATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks