EMAIL THIS PAGE TO A FRIEND

WDR27

WD repeat domain 27

UniProtKB ID: A2RRH5, A5PLM8, C9JGV0, Q5T066
Gene ID:
Mouse(71682) WD repeat domain 27
Rat(308222) WD repeat domain 27
Zebrafish(641503) WD repeat domain 27
chicken(100857387) WD repeat domain 27
dog(612528) WD repeat domain 27
domestic cat(101082660) WD repeat domain 27
cow(788957) WD repeat domain 27
sheep(101117085) WD repeat domain 27
naked mole-rat(101708074) WD repeat domain 27
domestic guinea pig(100734702) WD repeat domain 27
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064661 MISSION® esiRNA esiRNA human WDR27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182552 Rosetta Predictions human pricing
XM_001055617 Rosetta Predictions rat pricing
XM_218008 Rosetta Predictions rat pricing
NM_175173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053079 predicted 766
2 SASI_Hs02_00370665 predicted 2949
3 SASI_Hs01_00053080 predicted 1740
4 SASI_Hs01_00053081 predicted 2576
5 SASI_Hs01_00053082 predicted 1624
6 SASI_Hs02_00370666 predicted 2148
7 SASI_Hs02_00370667 predicted 2421
8 SASI_Hs01_00053084 predicted 684
9 SASI_Hs01_00053086 predicted 1888
10 SASI_Hs02_00370668 predicted 3140
11 SASI_Hs01_00053078 predicted 1073
12 SASI_Hs01_00053083 predicted 1111
13 SASI_Hs01_00053085 predicted 332
14 SASI_Hs01_00053087 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280332 predicted 810
2 SASI_Rn02_00280333 predicted 954
3 SASI_Rn02_00280334 predicted 592
4 SASI_Rn02_00280335 predicted 1636
5 SASI_Rn02_00280336 predicted 1629
6 SASI_Rn02_00280337 predicted 1346
7 SASI_Rn02_00280338 predicted 468
8 SASI_Rn02_00280339 predicted 274
9 SASI_Rn02_00280340 predicted 1450
10 SASI_Rn02_00280341 predicted 2039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377435 predicted 589
2 SASI_Rn02_00377436 predicted 487
3 SASI_Rn02_00377437 predicted 484
4 SASI_Rn02_00377438 predicted 547
5 SASI_Rn02_00377439 predicted 471
6 SASI_Rn02_00377440 predicted 2191
7 SASI_Rn02_00377441 predicted 280
8 SASI_Rn02_00377442 predicted 2036
9 SASI_Rn02_00377443 predicted 2093
10 SASI_Rn02_00377444 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167078 predicted 223
2 SASI_Mm01_00167079 predicted 626
3 SASI_Mm01_00167080 predicted 402
4 SASI_Mm02_00345807 predicted 762
5 SASI_Mm02_00345808 predicted 2419
6 SASI_Mm01_00167084 predicted 662
7 SASI_Mm01_00167085 predicted 1163
8 SASI_Mm01_00167086 predicted 1339
9 SASI_Mm01_00167087 predicted 1823
10 SASI_Mm02_00345809 predicted 2272
11 SASI_Mm01_00167081 predicted 903
12 SASI_Mm01_00167082 predicted 1474
13 SASI_Mm01_00167083 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182552
WDR27 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 27
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2942s21c1
Sequence:CCGGCACGCTTACGTGTATGAAATGCTCGAGCATTTCATACACGTAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2417s21c1
Sequence:CCGGCAGTCTGCACAGTTCTATTATCTCGAGATAATAGAACTGTGCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-1466s21c1
Sequence:CCGGGAGCAGGTTGAAGTAACATTTCTCGAGAAATGTTACTTCAACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3202s21c1
Sequence:CCGGTTGAGACTTGCCTCAGATTTCCTCGAGGAAATCTGAGGCAAGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3269s21c1
Sequence:CCGGTATGTCTTTCTGCTCCTCAAACTCGAGTTTGAGGAGCAGAAAGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2478s21c1
Sequence:CCGGAGCTACTGAGGTATCACATTGCTCGAGCAATGTGATACCTCAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-1588s21c1
Sequence:CCGGAGTGGGCTTATTCGTATTTAACTCGAGTTAAATACGAATAAGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2761s21c1
Sequence:CCGGCCAACAGCCTCAGGCTTATAACTCGAGTTATAAGCCTGAGGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3151s21c1
Sequence:CCGGAGTAGTGGTTCATCCATCAGGCTCGAGCCTGATGGATGAACCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2307s1c1
Sequence:CCGGCCTGTCCATCAAATCTGCCAACTCGAGTTGGCAGATTTGATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-1222s1c1
Sequence:CCGGCTGCTTTGTATTACAAGGATTCTCGAGAATCCTTGTAATACAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-555s1c1
Sequence:CCGGCTGGATATTGAGCAGCGATTTCTCGAGAAATCGCTGCTCAATATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-2832s1c1
Sequence:CCGGGAATGCTGTGAGGAACAACTTCTCGAGAAGTTGTTCCTCACAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2243s1c1
Sequence:CCGGCGTGGAAGTGTTTGACCTCAACTCGAGTTGAGGTCAAACACTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2467s1c1
Sequence:CCGGGCTATCCATGTGGAATCGCTTCTCGAGAAGCGATTCCACATGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-3035s1c1
Sequence:CCGGGTCCAGTACTTCTGCACAGAACTCGAGTTCTGTGCAGAAGTACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-1221s1c1
Sequence:CCGGGCTGCTTTGTATTACAAGGATCTCGAGATCCTTGTAATACAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-411s1c1
Sequence:CCGGCTGGATGAATGTAGAGAGAAACTCGAGTTTCTCTCTACATTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-1177s1c1
Sequence:CCGGCAGTGGGCTTATTCGTATTTACTCGAGTAAATACGAATAAGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-600s1c1
Sequence:CCGGGATGTTAATAACCGCCACAAACTCGAGTTTGTGGCGGTTATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182552
WDR27 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 27
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2942s21c1
Sequence:CCGGCACGCTTACGTGTATGAAATGCTCGAGCATTTCATACACGTAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2417s21c1
Sequence:CCGGCAGTCTGCACAGTTCTATTATCTCGAGATAATAGAACTGTGCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-1466s21c1
Sequence:CCGGGAGCAGGTTGAAGTAACATTTCTCGAGAAATGTTACTTCAACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3202s21c1
Sequence:CCGGTTGAGACTTGCCTCAGATTTCCTCGAGGAAATCTGAGGCAAGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3269s21c1
Sequence:CCGGTATGTCTTTCTGCTCCTCAAACTCGAGTTTGAGGAGCAGAAAGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2478s21c1
Sequence:CCGGAGCTACTGAGGTATCACATTGCTCGAGCAATGTGATACCTCAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-1588s21c1
Sequence:CCGGAGTGGGCTTATTCGTATTTAACTCGAGTTAAATACGAATAAGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2761s21c1
Sequence:CCGGCCAACAGCCTCAGGCTTATAACTCGAGTTATAAGCCTGAGGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3151s21c1
Sequence:CCGGAGTAGTGGTTCATCCATCAGGCTCGAGCCTGATGGATGAACCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2307s1c1
Sequence:CCGGCCTGTCCATCAAATCTGCCAACTCGAGTTGGCAGATTTGATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-1222s1c1
Sequence:CCGGCTGCTTTGTATTACAAGGATTCTCGAGAATCCTTGTAATACAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-555s1c1
Sequence:CCGGCTGGATATTGAGCAGCGATTTCTCGAGAAATCGCTGCTCAATATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-2832s1c1
Sequence:CCGGGAATGCTGTGAGGAACAACTTCTCGAGAAGTTGTTCCTCACAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2243s1c1
Sequence:CCGGCGTGGAAGTGTTTGACCTCAACTCGAGTTGAGGTCAAACACTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2467s1c1
Sequence:CCGGGCTATCCATGTGGAATCGCTTCTCGAGAAGCGATTCCACATGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-3035s1c1
Sequence:CCGGGTCCAGTACTTCTGCACAGAACTCGAGTTCTGTGCAGAAGTACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-1221s1c1
Sequence:CCGGGCTGCTTTGTATTACAAGGATCTCGAGATCCTTGTAATACAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-411s1c1
Sequence:CCGGCTGGATGAATGTAGAGAGAAACTCGAGTTTCTCTCTACATTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-1177s1c1
Sequence:CCGGCAGTGGGCTTATTCGTATTTACTCGAGTAAATACGAATAAGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-600s1c1
Sequence:CCGGGATGTTAATAACCGCCACAAACTCGAGTTTGTGGCGGTTATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182552
WDR27 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 27
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2942s21c1
Sequence:CCGGCACGCTTACGTGTATGAAATGCTCGAGCATTTCATACACGTAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2417s21c1
Sequence:CCGGCAGTCTGCACAGTTCTATTATCTCGAGATAATAGAACTGTGCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-1466s21c1
Sequence:CCGGGAGCAGGTTGAAGTAACATTTCTCGAGAAATGTTACTTCAACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3202s21c1
Sequence:CCGGTTGAGACTTGCCTCAGATTTCCTCGAGGAAATCTGAGGCAAGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3269s21c1
Sequence:CCGGTATGTCTTTCTGCTCCTCAAACTCGAGTTTGAGGAGCAGAAAGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2478s21c1
Sequence:CCGGAGCTACTGAGGTATCACATTGCTCGAGCAATGTGATACCTCAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-1588s21c1
Sequence:CCGGAGTGGGCTTATTCGTATTTAACTCGAGTTAAATACGAATAAGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182552.3-2761s21c1
Sequence:CCGGCCAACAGCCTCAGGCTTATAACTCGAGTTATAAGCCTGAGGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182552.3-3151s21c1
Sequence:CCGGAGTAGTGGTTCATCCATCAGGCTCGAGCCTGATGGATGAACCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2307s1c1
Sequence:CCGGCCTGTCCATCAAATCTGCCAACTCGAGTTGGCAGATTTGATGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-1222s1c1
Sequence:CCGGCTGCTTTGTATTACAAGGATTCTCGAGAATCCTTGTAATACAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-555s1c1
Sequence:CCGGCTGGATATTGAGCAGCGATTTCTCGAGAAATCGCTGCTCAATATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-2832s1c1
Sequence:CCGGGAATGCTGTGAGGAACAACTTCTCGAGAAGTTGTTCCTCACAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2243s1c1
Sequence:CCGGCGTGGAAGTGTTTGACCTCAACTCGAGTTGAGGTCAAACACTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-2467s1c1
Sequence:CCGGGCTATCCATGTGGAATCGCTTCTCGAGAAGCGATTCCACATGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-3035s1c1
Sequence:CCGGGTCCAGTACTTCTGCACAGAACTCGAGTTCTGTGCAGAAGTACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-1221s1c1
Sequence:CCGGGCTGCTTTGTATTACAAGGATCTCGAGATCCTTGTAATACAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-411s1c1
Sequence:CCGGCTGGATGAATGTAGAGAGAAACTCGAGTTTCTCTCTACATTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182552.2-1177s1c1
Sequence:CCGGCAGTGGGCTTATTCGTATTTACTCGAGTAAATACGAATAAGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182552.2-600s1c1
Sequence:CCGGGATGTTAATAACCGCCACAAACTCGAGTTTGTGGCGGTTATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175173
WDR27 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 27
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.3-299s1c1
Sequence:CCGGCTCTGCATCAGAGGATTATATCTCGAGATATAATCCTCTGATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.3-2181s1c1
Sequence:CCGGCAGCATTCCCTGGCATATAATCTCGAGATTATATGCCAGGGAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-407s21c1
Sequence:CCGGAGTGTTGTGTTTGCGATTTAGCTCGAGCTAAATCGCAAACACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-1929s21c1
Sequence:CCGGGATGACATACGAAGGTATAAACTCGAGTTTATACCTTCGTATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-2132s21c1
Sequence:CCGGCAGGCCTGTTCATCGAATTTGCTCGAGCAAATTCGATGAACAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-299s21c1
Sequence:CCGGCTCTGCATCAGAGGATTATATCTCGAGATATAATCCTCTGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175173.3-2379s21c1
Sequence:CCGGACGGGAAACTTCAGCTATTTGCTCGAGCAAATAGCTGAAGTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.2-1403s1c1
Sequence:CCGGGCTATACATTGGCACCACATACTCGAGTATGTGGTGCCAATGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175173
WDR27 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 27
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.3-299s1c1
Sequence:CCGGCTCTGCATCAGAGGATTATATCTCGAGATATAATCCTCTGATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.3-2181s1c1
Sequence:CCGGCAGCATTCCCTGGCATATAATCTCGAGATTATATGCCAGGGAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-407s21c1
Sequence:CCGGAGTGTTGTGTTTGCGATTTAGCTCGAGCTAAATCGCAAACACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-1929s21c1
Sequence:CCGGGATGACATACGAAGGTATAAACTCGAGTTTATACCTTCGTATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-2132s21c1
Sequence:CCGGCAGGCCTGTTCATCGAATTTGCTCGAGCAAATTCGATGAACAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-299s21c1
Sequence:CCGGCTCTGCATCAGAGGATTATATCTCGAGATATAATCCTCTGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175173.3-2379s21c1
Sequence:CCGGACGGGAAACTTCAGCTATTTGCTCGAGCAAATAGCTGAAGTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.2-1403s1c1
Sequence:CCGGGCTATACATTGGCACCACATACTCGAGTATGTGGTGCCAATGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175173
WDR27 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 27
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.3-299s1c1
Sequence:CCGGCTCTGCATCAGAGGATTATATCTCGAGATATAATCCTCTGATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.3-2181s1c1
Sequence:CCGGCAGCATTCCCTGGCATATAATCTCGAGATTATATGCCAGGGAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-407s21c1
Sequence:CCGGAGTGTTGTGTTTGCGATTTAGCTCGAGCTAAATCGCAAACACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-1929s21c1
Sequence:CCGGGATGACATACGAAGGTATAAACTCGAGTTTATACCTTCGTATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-2132s21c1
Sequence:CCGGCAGGCCTGTTCATCGAATTTGCTCGAGCAAATTCGATGAACAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175173.3-299s21c1
Sequence:CCGGCTCTGCATCAGAGGATTATATCTCGAGATATAATCCTCTGATGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175173.3-2379s21c1
Sequence:CCGGACGGGAAACTTCAGCTATTTGCTCGAGCAAATAGCTGAAGTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175173.2-1403s1c1
Sequence:CCGGGCTATACATTGGCACCACATACTCGAGTATGTGGTGCCAATGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks