EMAIL THIS PAGE TO A FRIEND

WDR31

WD repeat domain 31

UniProtKB ID: Q8NA23, Q5W0T9, Q96EG8
Gene ID:
Human(114987) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(71354) WD repeat domain 31
Rat(298096) WD repeat domain 31
chicken(417271) WD repeat domain 31
dog(612541) WD repeat domain 31
Horse(100052974) WD repeat domain 31
domestic cat(101081840) WD repeat domain 31
cow(528277) WD repeat domain 31
sheep(101107069) WD repeat domain 31
naked mole-rat(101703366) WD repeat domain 31
domestic guinea pig(100722512) WD repeat domain 31
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145241 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006615 Rosetta Predictions human pricing
NM_001012361 Rosetta Predictions human pricing
NM_145241 Rosetta Predictions human pricing
NM_001011976 Rosetta Predictions rat pricing
NM_023597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128351 predicted 786
2 SASI_Hs01_00128352 predicted 1129
3 SASI_Hs01_00128353 predicted 1152
4 SASI_Hs01_00128354 predicted 1308
5 SASI_Hs01_00128355 predicted 962
6 SASI_Hs01_00128356 predicted 711
7 SASI_Hs01_00128357 predicted 920
8 SASI_Hs01_00128359 predicted 1048
9 SASI_Hs02_00305088 predicted 995
10 SASI_Hs01_00128360 predicted 1274
11 SASI_Hs01_00128358 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022681 predicted 914
2 SASI_Hs01_00022682 predicted 1258
3 SASI_Hs01_00022683 predicted 1290
4 SASI_Hs01_00022684 predicted 1437
5 SASI_Hs01_00022685 predicted 1104
6 SASI_Hs01_00022686 predicted 839
7 SASI_Hs01_00022687 predicted 1048
8 SASI_Hs01_00022689 predicted 1181
9 SASI_Hs02_00306087 predicted 1125
10 SASI_Hs01_00022690 predicted 1408
11 SASI_Hs01_00022688 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213603 predicted 909
2 SASI_Hs01_00213604 predicted 1253
3 SASI_Hs01_00213605 predicted 1280
4 SASI_Hs01_00213606 predicted 1432
5 SASI_Hs01_00213607 predicted 1098
6 SASI_Hs01_00213608 predicted 841
7 SASI_Hs01_00213609 predicted 1042
8 SASI_Hs01_00213611 predicted 1179
9 SASI_Hs02_00365083 predicted 1131
10 SASI_Hs01_00213612 predicted 1410
11 SASI_Hs01_00213610 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109664 predicted 514
2 SASI_Rn01_00109665 predicted 996
3 SASI_Rn01_00109666 predicted 789
4 SASI_Rn01_00109667 predicted 482
5 SASI_Rn02_00199998 predicted 806
6 SASI_Rn01_00109668 predicted 1082
7 SASI_Rn01_00109669 predicted 1088
8 SASI_Rn01_00109670 predicted 402
9 SASI_Rn01_00109671 predicted 1065
10 SASI_Rn01_00109672 predicted 958
11 SASI_Rn01_00109673 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193200 predicted 292
2 SASI_Mm01_00193201 predicted 958
3 SASI_Mm01_00193203 predicted 842
4 SASI_Mm01_00193204 predicted 674
5 SASI_Mm01_00193205 predicted 786
6 SASI_Mm01_00193206 predicted 369
7 SASI_Mm01_00193207 predicted 295
8 SASI_Mm01_00193208 predicted 354
9 SASI_Mm01_00193209 predicted 798
10 SASI_Mm02_00327204 predicted 270
11 SASI_Mm01_00193202 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023597
VALIDATED
WDR31 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 31
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-983s21c1
Sequence:CCGGGACAGAATGTGTGAGTATAAGCTCGAGCTTATACTCACACATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-897s21c1
Sequence:CCGGTGGATGGACACACGTGTATTTCTCGAGAAATACACGTGTGTCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-486s21c1
Sequence:CCGGAGCGGGAAATCACGAAGATAGCTCGAGCTATCTTCGTGATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-1188s21c1
Sequence:CCGGCCTCCTTGTTATGCGCAAGTTCTCGAGAACTTGCGCATAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-387s21c1
Sequence:CCGGCTCTGAACTCAGACCTTTGTACTCGAGTACAAAGGTCTGAGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-1188s1c1
Sequence:CCGGCCTCCTTGTTATGCGCAAGTTCTCGAGAACTTGCGCATAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023597.1-1049s1c1
Sequence:CCGGACGGCCTTGATGCCTATGATTCTCGAGAATCATAGGCATCAAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-485s1c1
Sequence:CCGGGAGCGGGAAATCACGAAGATACTCGAGTATCTTCGTGATTTCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-387s1c1
Sequence:CCGGCTCTGAACTCAGACCTTTGTACTCGAGTACAAAGGTCTGAGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-384s1c1
Sequence:CCGGCCACTCTGAACTCAGACCTTTCTCGAGAAAGGTCTGAGTTCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023597
VALIDATED
WDR31 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 31
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-983s21c1
Sequence:CCGGGACAGAATGTGTGAGTATAAGCTCGAGCTTATACTCACACATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-897s21c1
Sequence:CCGGTGGATGGACACACGTGTATTTCTCGAGAAATACACGTGTGTCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-486s21c1
Sequence:CCGGAGCGGGAAATCACGAAGATAGCTCGAGCTATCTTCGTGATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-1188s21c1
Sequence:CCGGCCTCCTTGTTATGCGCAAGTTCTCGAGAACTTGCGCATAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-387s21c1
Sequence:CCGGCTCTGAACTCAGACCTTTGTACTCGAGTACAAAGGTCTGAGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-1188s1c1
Sequence:CCGGCCTCCTTGTTATGCGCAAGTTCTCGAGAACTTGCGCATAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023597.1-1049s1c1
Sequence:CCGGACGGCCTTGATGCCTATGATTCTCGAGAATCATAGGCATCAAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-485s1c1
Sequence:CCGGGAGCGGGAAATCACGAAGATACTCGAGTATCTTCGTGATTTCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-387s1c1
Sequence:CCGGCTCTGAACTCAGACCTTTGTACTCGAGTACAAAGGTCTGAGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-384s1c1
Sequence:CCGGCCACTCTGAACTCAGACCTTTCTCGAGAAAGGTCTGAGTTCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023597
VALIDATED
WDR31 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 31
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-983s21c1
Sequence:CCGGGACAGAATGTGTGAGTATAAGCTCGAGCTTATACTCACACATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-897s21c1
Sequence:CCGGTGGATGGACACACGTGTATTTCTCGAGAAATACACGTGTGTCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-486s21c1
Sequence:CCGGAGCGGGAAATCACGAAGATAGCTCGAGCTATCTTCGTGATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-1188s21c1
Sequence:CCGGCCTCCTTGTTATGCGCAAGTTCTCGAGAACTTGCGCATAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023597.1-387s21c1
Sequence:CCGGCTCTGAACTCAGACCTTTGTACTCGAGTACAAAGGTCTGAGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-1188s1c1
Sequence:CCGGCCTCCTTGTTATGCGCAAGTTCTCGAGAACTTGCGCATAACAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023597.1-1049s1c1
Sequence:CCGGACGGCCTTGATGCCTATGATTCTCGAGAATCATAGGCATCAAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-485s1c1
Sequence:CCGGGAGCGGGAAATCACGAAGATACTCGAGTATCTTCGTGATTTCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-387s1c1
Sequence:CCGGCTCTGAACTCAGACCTTTGTACTCGAGTACAAAGGTCTGAGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023597.1-384s1c1
Sequence:CCGGCCACTCTGAACTCAGACCTTTCTCGAGAAAGGTCTGAGTTCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145241
WDR31 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 31
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-287s21c1
Sequence:CCGGCTCCACAGAAGGTTTCGTTTACTCGAGTAAACGAAACCTTCTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145241.2-1487s21c1
Sequence:CCGGTCAGTGTTGTAAGTCCAATAACTCGAGTTATTGGACTTACAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-497s21c1
Sequence:CCGGAGACAGTTGTGGCCTATAATTCTCGAGAATTATAGGCCACAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-565s21c1
Sequence:CCGGATCACCAAGGTAGCCTGTATTCTCGAGAATACAGGCTACCTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-363s21c1
Sequence:CCGGATACGGGCCTGATGAAATTATCTCGAGATAATTTCATCAGGCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-1138s1c1
Sequence:CCGGCATGATTGCAAGGTGAAGATTCTCGAGAATCTTCACCTTGCAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-277s1c1
Sequence:CCGGCAGAAGGTTTCGTTTAGGTTTCTCGAGAAACCTAAACGAAACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-541s1c1
Sequence:CCGGGAACATGAGATCACCAAGGTACTCGAGTACCTTGGTGATCTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145241
WDR31 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 31
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-287s21c1
Sequence:CCGGCTCCACAGAAGGTTTCGTTTACTCGAGTAAACGAAACCTTCTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145241.2-1487s21c1
Sequence:CCGGTCAGTGTTGTAAGTCCAATAACTCGAGTTATTGGACTTACAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-497s21c1
Sequence:CCGGAGACAGTTGTGGCCTATAATTCTCGAGAATTATAGGCCACAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-565s21c1
Sequence:CCGGATCACCAAGGTAGCCTGTATTCTCGAGAATACAGGCTACCTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-363s21c1
Sequence:CCGGATACGGGCCTGATGAAATTATCTCGAGATAATTTCATCAGGCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-1138s1c1
Sequence:CCGGCATGATTGCAAGGTGAAGATTCTCGAGAATCTTCACCTTGCAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-277s1c1
Sequence:CCGGCAGAAGGTTTCGTTTAGGTTTCTCGAGAAACCTAAACGAAACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-541s1c1
Sequence:CCGGGAACATGAGATCACCAAGGTACTCGAGTACCTTGGTGATCTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145241
WDR31 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 31
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-287s21c1
Sequence:CCGGCTCCACAGAAGGTTTCGTTTACTCGAGTAAACGAAACCTTCTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145241.2-1487s21c1
Sequence:CCGGTCAGTGTTGTAAGTCCAATAACTCGAGTTATTGGACTTACAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-497s21c1
Sequence:CCGGAGACAGTTGTGGCCTATAATTCTCGAGAATTATAGGCCACAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-565s21c1
Sequence:CCGGATCACCAAGGTAGCCTGTATTCTCGAGAATACAGGCTACCTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145241.2-363s21c1
Sequence:CCGGATACGGGCCTGATGAAATTATCTCGAGATAATTTCATCAGGCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-1138s1c1
Sequence:CCGGCATGATTGCAAGGTGAAGATTCTCGAGAATCTTCACCTTGCAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-277s1c1
Sequence:CCGGCAGAAGGTTTCGTTTAGGTTTCTCGAGAAACCTAAACGAAACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145241.1-541s1c1
Sequence:CCGGGAACATGAGATCACCAAGGTACTCGAGTACCTTGGTGATCTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks