EMAIL THIS PAGE TO A FRIEND

WDR33

WD repeat domain 33

Synonyms: NET14 WDC146
Gene ID:
Human(55339) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(74320) WD repeat domain 33
Rat(307524) WD repeat domain 33
Zebrafish(449009) WD repeat domain 33
Horse(100067505) WD repeat domain 33
domestic cat(101092953) WD repeat domain 33
dog(483865) WD repeat domain 33
chicken(424753) WD repeat domain 33
domestic guinea pig(100725072) WD repeat domain 33
naked mole-rat(101702113) WD repeat domain 33
cow(541270) WD repeat domain 33
sheep(101108367) WD repeat domain 33
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118901 MISSION® esiRNA esiRNA human WDR33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006622 Rosetta Predictions human pricing
NM_001006623 Rosetta Predictions human pricing
NM_018383 Rosetta Predictions human pricing
NM_001107398 Rosetta Predictions rat pricing
NM_028866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214028 predicted 285
2 SASI_Hs01_00214029 predicted 518
3 SASI_Hs01_00214030 predicted 460
4 SASI_Hs01_00214031 predicted 353
5 SASI_Hs01_00214032 predicted 350
6 SASI_Hs01_00214034 predicted 460
7 SASI_Hs01_00214035 predicted 461
8 SASI_Hs01_00214036 predicted 356
9 SASI_Hs02_00305095 predicted 404
10 SASI_Hs02_00305096 predicted 406
11 SASI_Hs01_00214033 predicted 373
12 SASI_Hs01_00214037 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160172 predicted 287
2 SASI_Hs01_00160173 predicted 515
3 SASI_Hs01_00160174 predicted 456
4 SASI_Hs01_00160175 predicted 351
5 SASI_Hs01_00160176 predicted 347
6 SASI_Hs01_00160178 predicted 454
7 SASI_Hs01_00160179 predicted 464
8 SASI_Hs01_00160180 predicted 358
9 SASI_Hs02_00305097 predicted 408
10 SASI_Hs02_00305098 predicted 407
11 SASI_Hs01_00160177 predicted 368
12 SASI_Hs01_00160181 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040697 predicted 285
2 SASI_Hs01_00040698 predicted 517
3 SASI_Hs01_00040699 predicted 456
4 SASI_Hs01_00040700 predicted 351
5 SASI_Hs01_00040701 predicted 341
6 SASI_Hs01_00040703 predicted 457
7 SASI_Hs01_00040704 predicted 458
8 SASI_Hs01_00040705 predicted 356
9 SASI_Hs02_00351865 predicted 409
10 SASI_Hs02_00351866 predicted 408
11 SASI_Hs01_00040702 predicted 369
12 SASI_Hs01_00040706 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228425 predicted 3294
2 SASI_Rn02_00228426 predicted 3235
3 SASI_Rn02_00228427 predicted 1674
4 SASI_Rn02_00228428 predicted 1081
5 SASI_Rn02_00228429 predicted 731
6 SASI_Rn02_00228430 predicted 423
7 SASI_Rn02_00228431 predicted 350
8 SASI_Rn02_00228432 predicted 245
9 SASI_Rn02_00228433 predicted 877
10 SASI_Rn02_00228434 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044219 predicted 275
2 SASI_Mm01_00044220 predicted 1551
3 SASI_Mm01_00044221 predicted 954
4 SASI_Mm01_00044222 predicted 3138
5 SASI_Mm01_00044223 predicted 602
6 SASI_Mm01_00044224 predicted 751
7 SASI_Mm01_00044225 predicted 1779
8 SASI_Mm01_00044226 predicted 963
9 SASI_Mm01_00044227 predicted 1207
10 SASI_Mm01_00044228 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006622
WDR33 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 33
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-615s1c1
Sequence:CCGGCCTGTGGAATGGACTCACTTTCTCGAGAAAGTGAGTCCATTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-723s1c1
Sequence:CCGGCCACGGAGGATATGTGAAATACTCGAGTATTTCACATATCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-924s1c1
Sequence:CCGGGCACCCTATAAACACAATATTCTCGAGAATATTGTGTTTATAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-805s1c1
Sequence:CCGGGCCAGGTTTATACACAATATACTCGAGTATATTGTGTATAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-781s1c1
Sequence:CCGGGCACATAAGGAGGCGATTAGACTCGAGTCTAATCGCCTCCTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006622.1-1003s21c1
Sequence:CCGGCGGTATCAGCCTTTGCAATATCTCGAGATATTGCAAAGGCTGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006622.1-838s21c1
Sequence:CCGGGTCCCTATTGTCATGGTTAAACTCGAGTTTAACCATGACAATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006622
WDR33 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 33
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-615s1c1
Sequence:CCGGCCTGTGGAATGGACTCACTTTCTCGAGAAAGTGAGTCCATTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-723s1c1
Sequence:CCGGCCACGGAGGATATGTGAAATACTCGAGTATTTCACATATCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-924s1c1
Sequence:CCGGGCACCCTATAAACACAATATTCTCGAGAATATTGTGTTTATAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-805s1c1
Sequence:CCGGGCCAGGTTTATACACAATATACTCGAGTATATTGTGTATAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-781s1c1
Sequence:CCGGGCACATAAGGAGGCGATTAGACTCGAGTCTAATCGCCTCCTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006622.1-1003s21c1
Sequence:CCGGCGGTATCAGCCTTTGCAATATCTCGAGATATTGCAAAGGCTGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006622.1-838s21c1
Sequence:CCGGGTCCCTATTGTCATGGTTAAACTCGAGTTTAACCATGACAATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006622
WDR33 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 33
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-615s1c1
Sequence:CCGGCCTGTGGAATGGACTCACTTTCTCGAGAAAGTGAGTCCATTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-723s1c1
Sequence:CCGGCCACGGAGGATATGTGAAATACTCGAGTATTTCACATATCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-924s1c1
Sequence:CCGGGCACCCTATAAACACAATATTCTCGAGAATATTGTGTTTATAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-805s1c1
Sequence:CCGGGCCAGGTTTATACACAATATACTCGAGTATATTGTGTATAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006622.1-781s1c1
Sequence:CCGGGCACATAAGGAGGCGATTAGACTCGAGTCTAATCGCCTCCTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006622.1-1003s21c1
Sequence:CCGGCGGTATCAGCCTTTGCAATATCTCGAGATATTGCAAAGGCTGATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006622.1-838s21c1
Sequence:CCGGGTCCCTATTGTCATGGTTAAACTCGAGTTTAACCATGACAATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028866
VALIDATED
WDR33 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 33
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-1549s1c1
Sequence:CCGGGCTCCAAATGAGGTGCTGAATCTCGAGATTCAGCACCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-3481s1c1
Sequence:CCGGCCTGATGAGTTTCCTCGCTTTCTCGAGAAAGCGAGGAAACTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-1122s1c1
Sequence:CCGGCGAAGGGATGATCTGGAGTTTCTCGAGAAACTCCAGATCATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-3010s1c1
Sequence:CCGGCCTGATGACTTCAGACCAGATCTCGAGATCTGGTCTGAAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028866.2-635s1c1
Sequence:CCGGCCACGGATAATAAATTTGCTACTCGAGTAGCAAATTTATTATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-1549s21c1
Sequence:CCGGGCTCCAAATGAGGTGCTGAATCTCGAGATTCAGCACCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-247s21c1
Sequence:CCGGCAGCCGGATGCAGGTTATTATCTCGAGATAATAACCTGCATCCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-3010s21c1
Sequence:CCGGCCTGATGACTTCAGACCAGATCTCGAGATCTGGTCTGAAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-2367s21c1
Sequence:CCGGTCCTGCTCCTCAAGGGTTAATCTCGAGATTAACCCTTGAGGAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-1289s21c1
Sequence:CCGGATGATGACCTGGAGCCTAATACTCGAGTATTAGGCTCCAGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028866.2-1122s21c1
Sequence:CCGGCGAAGGGATGATCTGGAGTTTCTCGAGAAACTCCAGATCATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028866
VALIDATED
WDR33 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 33
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-1549s1c1
Sequence:CCGGGCTCCAAATGAGGTGCTGAATCTCGAGATTCAGCACCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-3481s1c1
Sequence:CCGGCCTGATGAGTTTCCTCGCTTTCTCGAGAAAGCGAGGAAACTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-1122s1c1
Sequence:CCGGCGAAGGGATGATCTGGAGTTTCTCGAGAAACTCCAGATCATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-3010s1c1
Sequence:CCGGCCTGATGACTTCAGACCAGATCTCGAGATCTGGTCTGAAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028866.2-635s1c1
Sequence:CCGGCCACGGATAATAAATTTGCTACTCGAGTAGCAAATTTATTATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-1549s21c1
Sequence:CCGGGCTCCAAATGAGGTGCTGAATCTCGAGATTCAGCACCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-247s21c1
Sequence:CCGGCAGCCGGATGCAGGTTATTATCTCGAGATAATAACCTGCATCCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-3010s21c1
Sequence:CCGGCCTGATGACTTCAGACCAGATCTCGAGATCTGGTCTGAAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-2367s21c1
Sequence:CCGGTCCTGCTCCTCAAGGGTTAATCTCGAGATTAACCCTTGAGGAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-1289s21c1
Sequence:CCGGATGATGACCTGGAGCCTAATACTCGAGTATTAGGCTCCAGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028866.2-1122s21c1
Sequence:CCGGCGAAGGGATGATCTGGAGTTTCTCGAGAAACTCCAGATCATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028866
VALIDATED
WDR33 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 33
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-1549s1c1
Sequence:CCGGGCTCCAAATGAGGTGCTGAATCTCGAGATTCAGCACCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-3481s1c1
Sequence:CCGGCCTGATGAGTTTCCTCGCTTTCTCGAGAAAGCGAGGAAACTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-1122s1c1
Sequence:CCGGCGAAGGGATGATCTGGAGTTTCTCGAGAAACTCCAGATCATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028866.2-3010s1c1
Sequence:CCGGCCTGATGACTTCAGACCAGATCTCGAGATCTGGTCTGAAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028866.2-635s1c1
Sequence:CCGGCCACGGATAATAAATTTGCTACTCGAGTAGCAAATTTATTATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-1549s21c1
Sequence:CCGGGCTCCAAATGAGGTGCTGAATCTCGAGATTCAGCACCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-247s21c1
Sequence:CCGGCAGCCGGATGCAGGTTATTATCTCGAGATAATAACCTGCATCCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-3010s21c1
Sequence:CCGGCCTGATGACTTCAGACCAGATCTCGAGATCTGGTCTGAAGTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-2367s21c1
Sequence:CCGGTCCTGCTCCTCAAGGGTTAATCTCGAGATTAACCCTTGAGGAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028866.2-1289s21c1
Sequence:CCGGATGATGACCTGGAGCCTAATACTCGAGTATTAGGCTCCAGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028866.2-1122s21c1
Sequence:CCGGCGAAGGGATGATCTGGAGTTTCTCGAGAAACTCCAGATCATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks