EMAIL THIS PAGE TO A FRIEND

WDR34

WD repeat domain 34

Synonyms: DIC5 bA216B9.3
UniProtKB ID: Q96EX3, Q5VXV4, Q9BV46
Gene ID:
Human(89891) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Mouse(71820) WD repeat domain 34
Rat(296618) WD repeat domain 34
cow(531489) WD repeat domain 34
sheep(101107182) WD repeat domain 34
naked mole-rat(101721707) WD repeat domain 34
domestic guinea pig(100715415) WD repeat domain 34
chicken(417211) WD repeat domain 34
dog(491314) WD repeat domain 34
domestic cat(101081338) WD repeat domain 34
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052844 Rosetta Predictions human pricing
NM_001005542 Rosetta Predictions rat pricing
NM_001008498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038845 predicted 553
2 SASI_Hs02_00361525 predicted 1503
3 SASI_Hs01_00038846 predicted 510
4 SASI_Hs01_00038849 predicted 1567
5 SASI_Hs02_00361526 predicted 565
6 SASI_Hs01_00038851 predicted 902
7 SASI_Hs01_00038852 predicted 1149
8 SASI_Hs01_00038853 predicted 1558
9 SASI_Hs02_00361527 predicted 1573
10 SASI_Hs01_00038854 predicted 679
11 SASI_Hs01_00038847 predicted 1299
12 SASI_Hs01_00038848 predicted 1010
13 SASI_Hs01_00038850 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118504 predicted 628
2 SASI_Rn01_00118505 predicted 350
3 SASI_Rn01_00118506 predicted 1409
4 SASI_Rn01_00118507 predicted 1390
5 SASI_Rn01_00118508 predicted 491
6 SASI_Rn01_00118509 predicted 670
7 SASI_Rn01_00118510 predicted 447
8 SASI_Rn01_00118511 predicted 793
9 SASI_Rn01_00118512 predicted 1372
10 SASI_Rn01_00118513 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038565 predicted 1471
2 SASI_Mm01_00038566 predicted 390
3 SASI_Mm01_00038567 predicted 561
4 SASI_Mm01_00038568 predicted 1502
5 SASI_Mm01_00038569 predicted 733
6 SASI_Mm01_00038570 predicted 397
7 SASI_Mm01_00038571 predicted 542
8 SASI_Mm01_00038572 predicted 1446
9 SASI_Mm01_00038573 predicted 1463
10 SASI_Mm01_00038574 predicted 1444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052844
VALIDATED
WDR34 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 34
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-1305s1c1
Sequence:CCGGCCATCTACTCTGTGAGCTGTTCTCGAGAACAGCTCACAGAGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-481s1c1
Sequence:CCGGCATCCGAGAGCTGAACAAGAACTCGAGTTCTTGTTCAGCTCTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1426s1c1
Sequence:CCGGCCTCAAGTATCTGTTTGCTGTCTCGAGACAGCAAACAGATACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052844.3-554s1c1
Sequence:CCGGCAGATGGTGTCTTGTCTGTATCTCGAGATACAGACAAGACACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1156s1c1
Sequence:CCGGCTTTGACCCTAGGCTGTTCATCTCGAGATGAACAGCCTAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-493s1c1
Sequence:CCGGGAACAAGAATTGGCAGAGCCACTCGAGTGGCTCTGCCAATTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1504s1c1
Sequence:CCGGGCAGCTGTTTGATCTCCAGAACTCGAGTTCTGGAGATCAAACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-1549s1c1
Sequence:CCGGGATCAAGCAAACCCAGGATGACTCGAGTCATCCTGGGTTTGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-517s1c1
Sequence:CCGGGTTTGATGGCTTCGAGGTGAACTCGAGTTCACCTCGAAGCCATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052844
VALIDATED
WDR34 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 34
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-1305s1c1
Sequence:CCGGCCATCTACTCTGTGAGCTGTTCTCGAGAACAGCTCACAGAGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-481s1c1
Sequence:CCGGCATCCGAGAGCTGAACAAGAACTCGAGTTCTTGTTCAGCTCTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1426s1c1
Sequence:CCGGCCTCAAGTATCTGTTTGCTGTCTCGAGACAGCAAACAGATACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052844.3-554s1c1
Sequence:CCGGCAGATGGTGTCTTGTCTGTATCTCGAGATACAGACAAGACACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1156s1c1
Sequence:CCGGCTTTGACCCTAGGCTGTTCATCTCGAGATGAACAGCCTAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-493s1c1
Sequence:CCGGGAACAAGAATTGGCAGAGCCACTCGAGTGGCTCTGCCAATTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1504s1c1
Sequence:CCGGGCAGCTGTTTGATCTCCAGAACTCGAGTTCTGGAGATCAAACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-1549s1c1
Sequence:CCGGGATCAAGCAAACCCAGGATGACTCGAGTCATCCTGGGTTTGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-517s1c1
Sequence:CCGGGTTTGATGGCTTCGAGGTGAACTCGAGTTCACCTCGAAGCCATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052844
VALIDATED
WDR34 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 34
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-1305s1c1
Sequence:CCGGCCATCTACTCTGTGAGCTGTTCTCGAGAACAGCTCACAGAGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-481s1c1
Sequence:CCGGCATCCGAGAGCTGAACAAGAACTCGAGTTCTTGTTCAGCTCTCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1426s1c1
Sequence:CCGGCCTCAAGTATCTGTTTGCTGTCTCGAGACAGCAAACAGATACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052844.3-554s1c1
Sequence:CCGGCAGATGGTGTCTTGTCTGTATCTCGAGATACAGACAAGACACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1156s1c1
Sequence:CCGGCTTTGACCCTAGGCTGTTCATCTCGAGATGAACAGCCTAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-493s1c1
Sequence:CCGGGAACAAGAATTGGCAGAGCCACTCGAGTGGCTCTGCCAATTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-1504s1c1
Sequence:CCGGGCAGCTGTTTGATCTCCAGAACTCGAGTTCTGGAGATCAAACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052844.3-1549s1c1
Sequence:CCGGGATCAAGCAAACCCAGGATGACTCGAGTCATCCTGGGTTTGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052844.3-517s1c1
Sequence:CCGGGTTTGATGGCTTCGAGGTGAACTCGAGTTCACCTCGAAGCCATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008498
WDR34 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 34
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1265s1c1
Sequence:CCGGGCTCTCTCACAAGTACCTGTTCTCGAGAACAGGTACTTGTGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1150s1c1
Sequence:CCGGCCGTGTATTCTGTGAGCTGTTCTCGAGAACAGCTCACAGAATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-354s1c1
Sequence:CCGGAGTCATGCCTTCGATGGCTATCTCGAGATAGCCATCGAAGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008498.1-1609s1c1
Sequence:CCGGAGCACTGACTACTCTTCTGAACTCGAGTTCAGAAGAGTAGTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1419s1c1
Sequence:CCGGCCTGTCTACTGTCTCGAGTTTCTCGAGAAACTCGAGACAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008498
WDR34 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 34
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1265s1c1
Sequence:CCGGGCTCTCTCACAAGTACCTGTTCTCGAGAACAGGTACTTGTGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1150s1c1
Sequence:CCGGCCGTGTATTCTGTGAGCTGTTCTCGAGAACAGCTCACAGAATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-354s1c1
Sequence:CCGGAGTCATGCCTTCGATGGCTATCTCGAGATAGCCATCGAAGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008498.1-1609s1c1
Sequence:CCGGAGCACTGACTACTCTTCTGAACTCGAGTTCAGAAGAGTAGTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1419s1c1
Sequence:CCGGCCTGTCTACTGTCTCGAGTTTCTCGAGAAACTCGAGACAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008498
WDR34 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 34
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1265s1c1
Sequence:CCGGGCTCTCTCACAAGTACCTGTTCTCGAGAACAGGTACTTGTGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1150s1c1
Sequence:CCGGCCGTGTATTCTGTGAGCTGTTCTCGAGAACAGCTCACAGAATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-354s1c1
Sequence:CCGGAGTCATGCCTTCGATGGCTATCTCGAGATAGCCATCGAAGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008498.1-1609s1c1
Sequence:CCGGAGCACTGACTACTCTTCTGAACTCGAGTTCAGAAGAGTAGTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008498.1-1419s1c1
Sequence:CCGGCCTGTCTACTGTCTCGAGTTTCTCGAGAAACTCGAGACAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks