EMAIL THIS PAGE TO A FRIEND

WDR35

WD repeat domain 35

Synonyms: CED2 IFT121
UniProtKB ID: Q9P2L0, B3KVI5, Q4ZG01, Q8NE11
Gene ID:
Human(57539) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
Mouse(74682) WD repeat domain 35
Rat(298876) WD repeat domain 35
Zebrafish(565515) WD repeat domain 35
chicken(421958) WD repeat domain 35
dog(475677) WD repeat domain 35
domestic guinea pig(100723470) WD repeat domain 35
naked mole-rat(101721184) WD repeat domain 35
cow(100337107) WD repeat domain 35
sheep(101103137) WD repeat domain 35
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020779 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006657 Rosetta Predictions human pricing
NM_020779 Rosetta Predictions human pricing
XM_001072062 Rosetta Predictions rat pricing
XM_233960 Rosetta Predictions rat pricing
NM_172470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189558 predicted 2989
2 SASI_Hs01_00189559 predicted 1893
3 SASI_Hs01_00189561 predicted 1632
4 SASI_Hs01_00189562 predicted 3020
5 SASI_Hs01_00189563 predicted 3298
6 SASI_Hs01_00189564 predicted 2305
7 SASI_Hs02_00305120 predicted 1886
8 SASI_Hs01_00189565 predicted 432
9 SASI_Hs02_00305121 predicted 1914
10 SASI_Hs01_00189567 predicted 2901
11 SASI_Hs01_00189560 predicted 2420
12 SASI_Hs01_00189566 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085183 predicted 2954
2 SASI_Hs01_00085184 predicted 1856
3 SASI_Hs01_00085186 predicted 1598
4 SASI_Hs01_00085187 predicted 2981
5 SASI_Hs01_00085188 predicted 3269
6 SASI_Hs01_00085189 predicted 2272
7 SASI_Hs02_00353926 predicted 1848
8 SASI_Hs01_00085190 predicted 435
9 SASI_Hs02_00353927 predicted 1889
10 SASI_Hs01_00085192 predicted 2865
11 SASI_Hs01_00085185 predicted 2383
12 SASI_Hs01_00085191 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337627 predicted 628
2 SASI_Rn02_00337628 predicted 3865
3 SASI_Rn02_00337629 predicted 1512
4 SASI_Rn02_00337630 predicted 416
5 SASI_Rn02_00337631 predicted 3081
6 SASI_Rn02_00337632 predicted 2693
7 SASI_Rn02_00337633 predicted 1472
8 SASI_Rn02_00337634 predicted 310
9 SASI_Rn02_00337635 predicted 3040
10 SASI_Rn02_00337636 predicted 1796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388150 predicted 371
2 SASI_Rn02_00388151 predicted 347
3 SASI_Rn02_00388152 predicted 868
4 SASI_Rn02_00388153 predicted 668
5 SASI_Rn02_00388154 predicted 1101
6 SASI_Rn02_00388155 predicted 232
7 SASI_Rn02_00388156 predicted 1060
8 SASI_Rn02_00388157 predicted 1205
9 SASI_Rn02_00388158 predicted 490
10 SASI_Rn02_00388159 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054328 predicted 1857
2 SASI_Mm02_00344017 predicted 1290
3 SASI_Mm01_00054329 predicted 360
4 SASI_Mm01_00054330 predicted 1526
5 SASI_Mm01_00054333 predicted 2068
6 SASI_Mm01_00054334 predicted 326
7 SASI_Mm01_00054335 predicted 599
8 SASI_Mm01_00054336 predicted 3099
9 SASI_Mm01_00054337 predicted 578
10 SASI_Mm02_00344018 predicted 1468
11 SASI_Mm01_00054331 predicted 1484
12 SASI_Mm01_00054332 predicted 3002
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172470
VALIDATED
WDR35 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 35
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172470.2-4216s1c1
Sequence:CCGGGCCAAGGTTACCAGTTGGTTACTCGAGTAACCAACTGGTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172470.2-298s1c1
Sequence:CCGGCCCAATAATGTGAAGCTGAAACTCGAGTTTCAGCTTCACATTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172470.2-1954s1c1
Sequence:CCGGGCTGGAGTCTTGACTTTCTTTCTCGAGAAAGAAAGTCAAGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172470.2-2497s1c1
Sequence:CCGGGCTGAAGTTATTGCCTACTTTCTCGAGAAAGTAGGCAATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172470.2-942s1c1
Sequence:CCGGCCTGGCAATTTGCTTTGACAACTCGAGTTGTCAAAGCAAATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-3775s21c1
Sequence:CCGGTGATTTCCTAAGGATTCATAGCTCGAGCTATGAATCCTTAGGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-4006s21c1
Sequence:CCGGTTTACAGGTGTGAACTAATTTCTCGAGAAATTAGTTCACACCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1433s21c1
Sequence:CCGGCATTGATCTTGTACCATTATTCTCGAGAATAATGGTACAAGATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1032s21c1
Sequence:CCGGGGTGAGCATCTGGGTACTTTGCTCGAGCAAAGTACCCAGATGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1904s21c1
Sequence:CCGGGGTCGTTGGCGAGTTGCTAAACTCGAGTTTAGCAACTCGCCAACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-4065s21c1
Sequence:CCGGCTTATAGTTTGTGGCAAATTACTCGAGTAATTTGCCACAAACTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1411s21c1
Sequence:CCGGGCACACCCTTGGACCCTAAATCTCGAGATTTAGGGTCCAAGGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1141s21c1
Sequence:CCGGCAAATATTCGACCTGATTATACTCGAGTATAATCAGGTCGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172470
VALIDATED
WDR35 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 35
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172470.2-4216s1c1
Sequence:CCGGGCCAAGGTTACCAGTTGGTTACTCGAGTAACCAACTGGTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172470.2-298s1c1
Sequence:CCGGCCCAATAATGTGAAGCTGAAACTCGAGTTTCAGCTTCACATTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172470.2-1954s1c1
Sequence:CCGGGCTGGAGTCTTGACTTTCTTTCTCGAGAAAGAAAGTCAAGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172470.2-2497s1c1
Sequence:CCGGGCTGAAGTTATTGCCTACTTTCTCGAGAAAGTAGGCAATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172470.2-942s1c1
Sequence:CCGGCCTGGCAATTTGCTTTGACAACTCGAGTTGTCAAAGCAAATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-3775s21c1
Sequence:CCGGTGATTTCCTAAGGATTCATAGCTCGAGCTATGAATCCTTAGGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-4006s21c1
Sequence:CCGGTTTACAGGTGTGAACTAATTTCTCGAGAAATTAGTTCACACCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1433s21c1
Sequence:CCGGCATTGATCTTGTACCATTATTCTCGAGAATAATGGTACAAGATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1032s21c1
Sequence:CCGGGGTGAGCATCTGGGTACTTTGCTCGAGCAAAGTACCCAGATGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1904s21c1
Sequence:CCGGGGTCGTTGGCGAGTTGCTAAACTCGAGTTTAGCAACTCGCCAACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-4065s21c1
Sequence:CCGGCTTATAGTTTGTGGCAAATTACTCGAGTAATTTGCCACAAACTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1411s21c1
Sequence:CCGGGCACACCCTTGGACCCTAAATCTCGAGATTTAGGGTCCAAGGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1141s21c1
Sequence:CCGGCAAATATTCGACCTGATTATACTCGAGTATAATCAGGTCGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172470
VALIDATED
WDR35 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 35
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172470.2-4216s1c1
Sequence:CCGGGCCAAGGTTACCAGTTGGTTACTCGAGTAACCAACTGGTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172470.2-298s1c1
Sequence:CCGGCCCAATAATGTGAAGCTGAAACTCGAGTTTCAGCTTCACATTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172470.2-1954s1c1
Sequence:CCGGGCTGGAGTCTTGACTTTCTTTCTCGAGAAAGAAAGTCAAGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172470.2-2497s1c1
Sequence:CCGGGCTGAAGTTATTGCCTACTTTCTCGAGAAAGTAGGCAATAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172470.2-942s1c1
Sequence:CCGGCCTGGCAATTTGCTTTGACAACTCGAGTTGTCAAAGCAAATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-3775s21c1
Sequence:CCGGTGATTTCCTAAGGATTCATAGCTCGAGCTATGAATCCTTAGGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-4006s21c1
Sequence:CCGGTTTACAGGTGTGAACTAATTTCTCGAGAAATTAGTTCACACCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1433s21c1
Sequence:CCGGCATTGATCTTGTACCATTATTCTCGAGAATAATGGTACAAGATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1032s21c1
Sequence:CCGGGGTGAGCATCTGGGTACTTTGCTCGAGCAAAGTACCCAGATGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1904s21c1
Sequence:CCGGGGTCGTTGGCGAGTTGCTAAACTCGAGTTTAGCAACTCGCCAACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172470.3-4065s21c1
Sequence:CCGGCTTATAGTTTGTGGCAAATTACTCGAGTAATTTGCCACAAACTATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1411s21c1
Sequence:CCGGGCACACCCTTGGACCCTAAATCTCGAGATTTAGGGTCCAAGGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172470.3-1141s21c1
Sequence:CCGGCAAATATTCGACCTGATTATACTCGAGTATAATCAGGTCGAATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020779
VALIDATED
WDR35 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 35
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020779.2-2639s1c1
Sequence:CCGGCCACAAGTTACTTCCAGAAATCTCGAGATTTCTGGAAGTAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-942s1c1
Sequence:CCGGCAGGACAAAGATGTGAACATTCTCGAGAATGTTCACATCTTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020779.2-1451s1c1
Sequence:CCGGGCTCACAGCATTGGAAATTAACTCGAGTTAATTTCCAATGCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-3508s1c1
Sequence:CCGGGCCCAATCACTGAGTATCAATCTCGAGATTGATACTCAGTGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-2871s1c1
Sequence:CCGGGCCATAGAACTCTATCGGAAACTCGAGTTTCCGATAGAGTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-2076s21c1
Sequence:CCGGGATTCGGTCTCTGCGAGATAGCTCGAGCTATCTCGCAGAGACCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-432s21c1
Sequence:CCGGGATGATCAACAATCGAAATAACTCGAGTTATTTCGATTGTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-595s21c1
Sequence:CCGGACATGGTCTGCGGACAGTAAACTCGAGTTTACTGTCCGCAGACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-3667s21c1
Sequence:CCGGTACATGGCTATATGCTGTATACTCGAGTATACAGCATATAGCCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-4073s21c1
Sequence:CCGGGCTTTCTCTATAGCCATATTTCTCGAGAAATATGGCTATAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-1093s21c1
Sequence:CCGGGCAAACATTCGACCTAATTATCTCGAGATAATTAGGTCGAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-3799s21c1
Sequence:CCGGGTGAAATAATAAGGCCGATTTCTCGAGAAATCGGCCTTATTATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020779
VALIDATED
WDR35 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 35
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020779.2-2639s1c1
Sequence:CCGGCCACAAGTTACTTCCAGAAATCTCGAGATTTCTGGAAGTAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-942s1c1
Sequence:CCGGCAGGACAAAGATGTGAACATTCTCGAGAATGTTCACATCTTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020779.2-1451s1c1
Sequence:CCGGGCTCACAGCATTGGAAATTAACTCGAGTTAATTTCCAATGCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-3508s1c1
Sequence:CCGGGCCCAATCACTGAGTATCAATCTCGAGATTGATACTCAGTGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-2871s1c1
Sequence:CCGGGCCATAGAACTCTATCGGAAACTCGAGTTTCCGATAGAGTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-2076s21c1
Sequence:CCGGGATTCGGTCTCTGCGAGATAGCTCGAGCTATCTCGCAGAGACCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-432s21c1
Sequence:CCGGGATGATCAACAATCGAAATAACTCGAGTTATTTCGATTGTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-595s21c1
Sequence:CCGGACATGGTCTGCGGACAGTAAACTCGAGTTTACTGTCCGCAGACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-3667s21c1
Sequence:CCGGTACATGGCTATATGCTGTATACTCGAGTATACAGCATATAGCCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-4073s21c1
Sequence:CCGGGCTTTCTCTATAGCCATATTTCTCGAGAAATATGGCTATAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-1093s21c1
Sequence:CCGGGCAAACATTCGACCTAATTATCTCGAGATAATTAGGTCGAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-3799s21c1
Sequence:CCGGGTGAAATAATAAGGCCGATTTCTCGAGAAATCGGCCTTATTATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020779
VALIDATED
WDR35 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 35
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020779.2-2639s1c1
Sequence:CCGGCCACAAGTTACTTCCAGAAATCTCGAGATTTCTGGAAGTAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-942s1c1
Sequence:CCGGCAGGACAAAGATGTGAACATTCTCGAGAATGTTCACATCTTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020779.2-1451s1c1
Sequence:CCGGGCTCACAGCATTGGAAATTAACTCGAGTTAATTTCCAATGCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-3508s1c1
Sequence:CCGGGCCCAATCACTGAGTATCAATCTCGAGATTGATACTCAGTGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020779.2-2871s1c1
Sequence:CCGGGCCATAGAACTCTATCGGAAACTCGAGTTTCCGATAGAGTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-2076s21c1
Sequence:CCGGGATTCGGTCTCTGCGAGATAGCTCGAGCTATCTCGCAGAGACCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-432s21c1
Sequence:CCGGGATGATCAACAATCGAAATAACTCGAGTTATTTCGATTGTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-595s21c1
Sequence:CCGGACATGGTCTGCGGACAGTAAACTCGAGTTTACTGTCCGCAGACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-3667s21c1
Sequence:CCGGTACATGGCTATATGCTGTATACTCGAGTATACAGCATATAGCCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-4073s21c1
Sequence:CCGGGCTTTCTCTATAGCCATATTTCTCGAGAAATATGGCTATAGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020779.3-1093s21c1
Sequence:CCGGGCAAACATTCGACCTAATTATCTCGAGATAATTAGGTCGAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020779.3-3799s21c1
Sequence:CCGGGTGAAATAATAAGGCCGATTTCTCGAGAAATCGGCCTTATTATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks