EMAIL THIS PAGE TO A FRIEND

WDR36

WD repeat domain 36

Synonyms: GLC1G TA-WDRP TAWDRP UTP21
UniProtKB ID: Q8NI36, A2RUS4, Q8N1Q2
Gene ID:
Human(134430) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Mutations in this gene have been associated with adult-onset primary open-angle glaucoma (POAG). [provided by RefSeq, Jul 2008]
Mouse(225348) WD repeat domain 36
Rat(361305) WD repeat domain 36
domestic guinea pig(100723602) WD repeat domain 36
naked mole-rat(101699776) WD repeat domain 36
Domestic Rabbit(100351582) WD repeat domain 36
cow(514267) WD repeat domain 36
sheep(101107787) WD repeat domain 36
Zebrafish(321745) WD repeat domain 36
Horse(100073193) WD repeat domain 36
domestic cat(101086116) WD repeat domain 36
dog(488875) WD repeat domain 36
chicken(415609) WD repeat domain 36
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139281 Rosetta Predictions human pricing
XM_001060069 Rosetta Predictions rat pricing
XM_341590 Rosetta Predictions rat pricing
NM_001110015 Rosetta Predictions mouse pricing
NM_001110016 Rosetta Predictions mouse pricing
NM_144863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189828 predicted 587
2 SASI_Hs01_00189829 predicted 2726
3 SASI_Hs01_00189830 predicted 1712
4 SASI_Hs01_00189831 predicted 448
5 SASI_Hs01_00189832 predicted 1780
6 SASI_Hs01_00189833 predicted 1253
7 SASI_Hs02_00364268 predicted 1278
8 SASI_Hs02_00364269 predicted 2510
9 SASI_Hs01_00189835 predicted 2358
10 SASI_Hs01_00189837 predicted 2323
11 SASI_Hs01_00189834 predicted 1764
12 SASI_Hs01_00189836 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295252 predicted 281
2 SASI_Rn02_00295253 predicted 952
3 SASI_Rn02_00295254 predicted 2391
4 SASI_Rn02_00295255 predicted 1379
5 SASI_Rn02_00295256 predicted 1087
6 SASI_Rn02_00295257 predicted 1003
7 SASI_Rn02_00295258 predicted 422
8 SASI_Rn02_00295259 predicted 1023
9 SASI_Rn02_00295260 predicted 1754
10 SASI_Rn02_00295261 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156912 predicted 764
2 SASI_Rn01_00156913 predicted 450
3 SASI_Rn01_00156914 predicted 1620
4 SASI_Rn01_00156915 predicted 1857
5 SASI_Rn01_00156916 predicted 1568
6 SASI_Rn01_00156917 predicted 1482
7 SASI_Rn01_00156918 predicted 902
8 SASI_Rn01_00156919 predicted 1506
9 SASI_Rn01_00156920 predicted 2971
10 SASI_Rn01_00156921 predicted 2230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304594 predicted 339
2 SASI_Mm02_00304595 predicted 1461
3 SASI_Mm02_00304596 predicted 1001
4 SASI_Mm02_00304597 predicted 544
5 SASI_Mm02_00304598 predicted 684
6 SASI_Mm02_00304599 predicted 1518
7 SASI_Mm02_00304600 predicted 361
8 SASI_Mm02_00304601 predicted 815
9 SASI_Mm02_00304602 predicted 1530
10 SASI_Mm02_00304603 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304604 predicted 334
2 SASI_Mm02_00304605 predicted 1462
3 SASI_Mm02_00304606 predicted 997
4 SASI_Mm02_00304607 predicted 543
5 SASI_Mm02_00304608 predicted 679
6 SASI_Mm02_00304609 predicted 1514
7 SASI_Mm02_00304610 predicted 360
8 SASI_Mm02_00304611 predicted 812
9 SASI_Mm02_00304612 predicted 1524
10 SASI_Mm02_00304613 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049673 predicted 335
2 SASI_Mm01_00049676 predicted 1460
3 SASI_Mm01_00049677 predicted 1003
4 SASI_Mm01_00049678 predicted 547
5 SASI_Mm01_00049679 predicted 687
6 SASI_Mm01_00049680 predicted 1512
7 SASI_Mm01_00049681 predicted 356
8 SASI_Mm02_00340291 predicted 817
9 SASI_Mm01_00049682 predicted 1527
10 SASI_Mm02_00340292 predicted 1053
11 SASI_Mm01_00049674 predicted 1409
12 SASI_Mm01_00049675 predicted 1714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139281
VALIDATED
WDR36 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 36
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-2164s21c1
Sequence:CCGGGTGGACCACCTTGGAATTTATCTCGAGATAAATTCCAAGGTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-1365s21c1
Sequence:CCGGGAGCTTGGGACATGGATTAATCTCGAGATTAATCCATGTCCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-583s21c1
Sequence:CCGGCATACCTTTAAGGGTCATAAGCTCGAGCTTATGACCCTTAAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139281.2-3087s21c1
Sequence:CCGGGTCAGTATATCTCCACTTTAACTCGAGTTAAAGTGGAGATATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139281.2-3318s21c1
Sequence:CCGGGAATCTGCTCAAATGATTTATCTCGAGATAAATCATTTGAGCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-1183s21c1
Sequence:CCGGGCTCTTAGGATATGGATATTTCTCGAGAAATATCCATATCCTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-552s21c1
Sequence:CCGGCTCTGCATTTGCCCGTAATAACTCGAGTTATTACGGGCAAATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-1910s1c1
Sequence:CCGGCCTTGGATGACTTCTCCATTACTCGAGTAATGGAGAAGTCATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-2547s1c1
Sequence:CCGGCCAGCAGTCTAAAGTGGTAAACTCGAGTTTACCACTTTAGACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139281.1-2797s1c1
Sequence:CCGGCAGGCATACCTTGCATTGTTTCTCGAGAAACAATGCAAGGTATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-1560s1c1
Sequence:CCGGCGCTTACTTTCTCAAGCCAAACTCGAGTTTGGCTTGAGAAAGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139281.1-889s1c1
Sequence:CCGGGCCGTGGATGTTGTTGCTATTCTCGAGAATAGCAACAACATCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139281
VALIDATED
WDR36 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 36
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-2164s21c1
Sequence:CCGGGTGGACCACCTTGGAATTTATCTCGAGATAAATTCCAAGGTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-1365s21c1
Sequence:CCGGGAGCTTGGGACATGGATTAATCTCGAGATTAATCCATGTCCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-583s21c1
Sequence:CCGGCATACCTTTAAGGGTCATAAGCTCGAGCTTATGACCCTTAAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139281.2-3087s21c1
Sequence:CCGGGTCAGTATATCTCCACTTTAACTCGAGTTAAAGTGGAGATATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139281.2-3318s21c1
Sequence:CCGGGAATCTGCTCAAATGATTTATCTCGAGATAAATCATTTGAGCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-1183s21c1
Sequence:CCGGGCTCTTAGGATATGGATATTTCTCGAGAAATATCCATATCCTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-552s21c1
Sequence:CCGGCTCTGCATTTGCCCGTAATAACTCGAGTTATTACGGGCAAATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-1910s1c1
Sequence:CCGGCCTTGGATGACTTCTCCATTACTCGAGTAATGGAGAAGTCATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-2547s1c1
Sequence:CCGGCCAGCAGTCTAAAGTGGTAAACTCGAGTTTACCACTTTAGACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139281.1-2797s1c1
Sequence:CCGGCAGGCATACCTTGCATTGTTTCTCGAGAAACAATGCAAGGTATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-1560s1c1
Sequence:CCGGCGCTTACTTTCTCAAGCCAAACTCGAGTTTGGCTTGAGAAAGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139281.1-889s1c1
Sequence:CCGGGCCGTGGATGTTGTTGCTATTCTCGAGAATAGCAACAACATCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139281
VALIDATED
WDR36 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 36
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-2164s21c1
Sequence:CCGGGTGGACCACCTTGGAATTTATCTCGAGATAAATTCCAAGGTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-1365s21c1
Sequence:CCGGGAGCTTGGGACATGGATTAATCTCGAGATTAATCCATGTCCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-583s21c1
Sequence:CCGGCATACCTTTAAGGGTCATAAGCTCGAGCTTATGACCCTTAAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139281.2-3087s21c1
Sequence:CCGGGTCAGTATATCTCCACTTTAACTCGAGTTAAAGTGGAGATATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139281.2-3318s21c1
Sequence:CCGGGAATCTGCTCAAATGATTTATCTCGAGATAAATCATTTGAGCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-1183s21c1
Sequence:CCGGGCTCTTAGGATATGGATATTTCTCGAGAAATATCCATATCCTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139281.2-552s21c1
Sequence:CCGGCTCTGCATTTGCCCGTAATAACTCGAGTTATTACGGGCAAATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-1910s1c1
Sequence:CCGGCCTTGGATGACTTCTCCATTACTCGAGTAATGGAGAAGTCATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-2547s1c1
Sequence:CCGGCCAGCAGTCTAAAGTGGTAAACTCGAGTTTACCACTTTAGACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139281.1-2797s1c1
Sequence:CCGGCAGGCATACCTTGCATTGTTTCTCGAGAAACAATGCAAGGTATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_139281.1-1560s1c1
Sequence:CCGGCGCTTACTTTCTCAAGCCAAACTCGAGTTTGGCTTGAGAAAGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139281.1-889s1c1
Sequence:CCGGGCCGTGGATGTTGTTGCTATTCTCGAGAATAGCAACAACATCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144863
VALIDATED
WDR36 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 36
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-1464s21c1
Sequence:CCGGCCAGAGGTGTAAAGACAAATACTCGAGTATTTGTCTTTACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-635s21c1
Sequence:CCGGTTGCATCCAAGCACCTATTTGCTCGAGCAAATAGGTGCTTGGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-1639s21c1
Sequence:CCGGTGTTGCCGTGGATGGATTAAACTCGAGTTTAATCCATCCACGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144863.4-1976s21c1
Sequence:CCGGTATCCTTATTCCCATTGTAAGCTCGAGCTTACAATGGGAATAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144863.4-550s21c1
Sequence:CCGGCGTTCTTATTATTTGGCACATCTCGAGATGTGCCAAATAATAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1049s1c1
Sequence:CCGGGTTACAAATGGCGCTGATAATCTCGAGATTATCAGCGCCATTTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1146s1c1
Sequence:CCGGCTCTTACCAAGATTAGATATTCTCGAGAATATCTAATCTTGGTAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1680s1c1
Sequence:CCGGGAAGTGAACGGTTACTCAAATCTCGAGATTTGAGTAACCGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.2-1772s1c1
Sequence:CCGGGCTATGGATGACTTCTCCATTCTCGAGAATGGAGAAGTCATCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144863.2-1984s1c1
Sequence:CCGGGAATGATAATTTGCAGGCTAACTCGAGTTAGCCTGCAAATTATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144863.2-1437s1c1
Sequence:CCGGCCAGAGGTGTAAAGACAAATACTCGAGTATTTGTCTTTACACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-523s1c1
Sequence:CCGGCGTTCTTATTATTTGGCACATCTCGAGATGTGCCAAATAATAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-2160s1c1
Sequence:CCGGGCTGAGAGAATTTATTTGTCTCTCGAGAGACAAATAAATTCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-1902s1c1
Sequence:CCGGCCTGTTTAGGAGAAAGATGTTCTCGAGAACATCTTTCTCCTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144863
VALIDATED
WDR36 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 36
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-1464s21c1
Sequence:CCGGCCAGAGGTGTAAAGACAAATACTCGAGTATTTGTCTTTACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-635s21c1
Sequence:CCGGTTGCATCCAAGCACCTATTTGCTCGAGCAAATAGGTGCTTGGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-1639s21c1
Sequence:CCGGTGTTGCCGTGGATGGATTAAACTCGAGTTTAATCCATCCACGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144863.4-1976s21c1
Sequence:CCGGTATCCTTATTCCCATTGTAAGCTCGAGCTTACAATGGGAATAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144863.4-550s21c1
Sequence:CCGGCGTTCTTATTATTTGGCACATCTCGAGATGTGCCAAATAATAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1049s1c1
Sequence:CCGGGTTACAAATGGCGCTGATAATCTCGAGATTATCAGCGCCATTTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1146s1c1
Sequence:CCGGCTCTTACCAAGATTAGATATTCTCGAGAATATCTAATCTTGGTAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1680s1c1
Sequence:CCGGGAAGTGAACGGTTACTCAAATCTCGAGATTTGAGTAACCGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.2-1772s1c1
Sequence:CCGGGCTATGGATGACTTCTCCATTCTCGAGAATGGAGAAGTCATCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144863.2-1984s1c1
Sequence:CCGGGAATGATAATTTGCAGGCTAACTCGAGTTAGCCTGCAAATTATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144863.2-1437s1c1
Sequence:CCGGCCAGAGGTGTAAAGACAAATACTCGAGTATTTGTCTTTACACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-523s1c1
Sequence:CCGGCGTTCTTATTATTTGGCACATCTCGAGATGTGCCAAATAATAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-2160s1c1
Sequence:CCGGGCTGAGAGAATTTATTTGTCTCTCGAGAGACAAATAAATTCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-1902s1c1
Sequence:CCGGCCTGTTTAGGAGAAAGATGTTCTCGAGAACATCTTTCTCCTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144863
VALIDATED
WDR36 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 36
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-1464s21c1
Sequence:CCGGCCAGAGGTGTAAAGACAAATACTCGAGTATTTGTCTTTACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-635s21c1
Sequence:CCGGTTGCATCCAAGCACCTATTTGCTCGAGCAAATAGGTGCTTGGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144863.4-1639s21c1
Sequence:CCGGTGTTGCCGTGGATGGATTAAACTCGAGTTTAATCCATCCACGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144863.4-1976s21c1
Sequence:CCGGTATCCTTATTCCCATTGTAAGCTCGAGCTTACAATGGGAATAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144863.4-550s21c1
Sequence:CCGGCGTTCTTATTATTTGGCACATCTCGAGATGTGCCAAATAATAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1049s1c1
Sequence:CCGGGTTACAAATGGCGCTGATAATCTCGAGATTATCAGCGCCATTTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1146s1c1
Sequence:CCGGCTCTTACCAAGATTAGATATTCTCGAGAATATCTAATCTTGGTAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.4-1680s1c1
Sequence:CCGGGAAGTGAACGGTTACTCAAATCTCGAGATTTGAGTAACCGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144863.2-1772s1c1
Sequence:CCGGGCTATGGATGACTTCTCCATTCTCGAGAATGGAGAAGTCATCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144863.2-1984s1c1
Sequence:CCGGGAATGATAATTTGCAGGCTAACTCGAGTTAGCCTGCAAATTATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144863.2-1437s1c1
Sequence:CCGGCCAGAGGTGTAAAGACAAATACTCGAGTATTTGTCTTTACACCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-523s1c1
Sequence:CCGGCGTTCTTATTATTTGGCACATCTCGAGATGTGCCAAATAATAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-2160s1c1
Sequence:CCGGGCTGAGAGAATTTATTTGTCTCTCGAGAGACAAATAAATTCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144863.2-1902s1c1
Sequence:CCGGCCTGTTTAGGAGAAAGATGTTCTCGAGAACATCTTTCTCCTAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks