EMAIL THIS PAGE TO A FRIEND

WDR37

WD repeat domain 37

Synonyms: RP11-529L18.2
UniProtKB ID: Q9Y2I8, D3DRQ7, Q5SW03, Q9NTJ6
Gene ID:
Human(22884) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Mouse(207615) WD repeat domain 37
Rat(307075) WD repeat domain 37
Zebrafish(558075) WD repeat domain 37
chicken(420460) WD repeat domain 37
domestic cat(101094767) WD repeat domain 37
Horse(100057572) WD repeat domain 37
dog(607652) WD repeat domain 37
cow(529876) WD repeat domain 37
sheep(101112244) WD repeat domain 37
naked mole-rat(101711568) WD repeat domain 37
domestic guinea pig(100733806) WD repeat domain 37
227 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014023 Rosetta Predictions human pricing
NM_001107362 Rosetta Predictions rat pricing
NM_001039388 Rosetta Predictions mouse pricing
NM_001039389 Rosetta Predictions mouse pricing
NM_172445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027897 predicted 289
2 SASI_Hs01_00027898 predicted 1720
3 SASI_Hs01_00027899 predicted 222
4 SASI_Hs01_00027900 predicted 564
5 SASI_Hs01_00027901 predicted 1619
6 SASI_Hs01_00027902 predicted 1588
7 SASI_Hs02_00345002 predicted 914
8 SASI_Hs01_00027904 predicted 1393
9 SASI_Hs01_00027905 predicted 1698
10 SASI_Hs02_00345003 predicted 1200
11 SASI_Hs01_00027903 predicted 417
12 SASI_Hs01_00027906 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228075 predicted 756
2 SASI_Rn02_00228076 predicted 605
3 SASI_Rn02_00228077 predicted 815
4 SASI_Rn02_00228078 predicted 1729
5 SASI_Rn02_00228079 predicted 877
6 SASI_Rn02_00228080 predicted 1710
7 SASI_Rn02_00228081 predicted 1651
8 SASI_Rn02_00228082 predicted 513
9 SASI_Rn02_00228083 predicted 1768
10 SASI_Rn02_00228084 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180708 predicted 777
2 SASI_Mm01_00180709 predicted 1830
3 SASI_Mm01_00180710 predicted 673
4 SASI_Mm01_00180711 predicted 847
5 SASI_Mm01_00180713 predicted 1796
6 SASI_Mm01_00180714 predicted 997
7 SASI_Mm01_00180715 predicted 1725
8 SASI_Mm01_00180716 predicted 1485
9 SASI_Mm01_00180717 predicted 1731
10 SASI_Mm02_00290028 predicted 1262
11 SASI_Mm01_00180712 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123082 predicted 379
2 SASI_Mm01_00123084 predicted 327
3 SASI_Mm01_00123085 predicted 357
4 SASI_Mm01_00123086 predicted 264
5 SASI_Mm01_00123087 predicted 373
6 SASI_Mm01_00123088 predicted 285
7 SASI_Mm02_00290029 predicted 369
8 SASI_Mm02_00290030 predicted 273
9 SASI_Mm02_00290031 predicted 290
10 SASI_Mm01_00123090 predicted 322
11 SASI_Mm01_00123083 predicted 321
12 SASI_Mm01_00123089 predicted 357
13 SASI_Mm01_00123091 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126559 predicted 696
2 SASI_Mm01_00126560 predicted 1764
3 SASI_Mm01_00126561 predicted 600
4 SASI_Mm01_00126562 predicted 775
5 SASI_Mm01_00126564 predicted 1724
6 SASI_Mm01_00126565 predicted 924
7 SASI_Mm01_00126566 predicted 1644
8 SASI_Mm01_00126567 predicted 1409
9 SASI_Mm01_00126568 predicted 1654
10 SASI_Mm02_00343953 predicted 1186
11 SASI_Mm01_00126563 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014023
WDR37 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 37
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014023.2-4057s1c1
Sequence:CCGGCGTCTGAAACAGTGTTTGGAACTCGAGTTCCAAACACTGTTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014023.2-389s1c1
Sequence:CCGGCGTAGAGAAATCGACACTCTTCTCGAGAAGAGTGTCGATTTCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-544s1c1
Sequence:CCGGCAAGATTGTCTCCAGCTTTAACTCGAGTTAAAGCTGGAGACAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-401s1c1
Sequence:CCGGGACACTCTTAATGAACGTTTACTCGAGTAAACGTTCATTAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-1379s1c1
Sequence:CCGGGCCATTAACAGGATCAATGTACTCGAGTACATTGATCCTGTTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014023.2-3647s1c1
Sequence:CCGGGCTGCAAATAGCCAAATCAAACTCGAGTTTGATTTGGCTATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-400s1c1
Sequence:CCGGCGACACTCTTAATGAACGTTTCTCGAGAAACGTTCATTAAGAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014023.2-2614s1c1
Sequence:CCGGGCTGGAATACTGAGTTCAGTTCTCGAGAACTGAACTCAGTATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014023.3-1463s21c1
Sequence:CCGGACAAGTGAGACTGTTTGATATCTCGAGATATCAAACAGTCTCACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014023.3-827s21c1
Sequence:CCGGTGGAGATCAGACTGCTCATATCTCGAGATATGAGCAGTCTGATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014023
WDR37 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 37
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014023.2-4057s1c1
Sequence:CCGGCGTCTGAAACAGTGTTTGGAACTCGAGTTCCAAACACTGTTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014023.2-389s1c1
Sequence:CCGGCGTAGAGAAATCGACACTCTTCTCGAGAAGAGTGTCGATTTCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-544s1c1
Sequence:CCGGCAAGATTGTCTCCAGCTTTAACTCGAGTTAAAGCTGGAGACAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-401s1c1
Sequence:CCGGGACACTCTTAATGAACGTTTACTCGAGTAAACGTTCATTAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-1379s1c1
Sequence:CCGGGCCATTAACAGGATCAATGTACTCGAGTACATTGATCCTGTTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014023.2-3647s1c1
Sequence:CCGGGCTGCAAATAGCCAAATCAAACTCGAGTTTGATTTGGCTATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-400s1c1
Sequence:CCGGCGACACTCTTAATGAACGTTTCTCGAGAAACGTTCATTAAGAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014023.2-2614s1c1
Sequence:CCGGGCTGGAATACTGAGTTCAGTTCTCGAGAACTGAACTCAGTATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014023.3-1463s21c1
Sequence:CCGGACAAGTGAGACTGTTTGATATCTCGAGATATCAAACAGTCTCACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014023.3-827s21c1
Sequence:CCGGTGGAGATCAGACTGCTCATATCTCGAGATATGAGCAGTCTGATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014023
WDR37 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 37
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014023.2-4057s1c1
Sequence:CCGGCGTCTGAAACAGTGTTTGGAACTCGAGTTCCAAACACTGTTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014023.2-389s1c1
Sequence:CCGGCGTAGAGAAATCGACACTCTTCTCGAGAAGAGTGTCGATTTCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-544s1c1
Sequence:CCGGCAAGATTGTCTCCAGCTTTAACTCGAGTTAAAGCTGGAGACAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-401s1c1
Sequence:CCGGGACACTCTTAATGAACGTTTACTCGAGTAAACGTTCATTAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-1379s1c1
Sequence:CCGGGCCATTAACAGGATCAATGTACTCGAGTACATTGATCCTGTTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014023.2-3647s1c1
Sequence:CCGGGCTGCAAATAGCCAAATCAAACTCGAGTTTGATTTGGCTATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014023.2-400s1c1
Sequence:CCGGCGACACTCTTAATGAACGTTTCTCGAGAAACGTTCATTAAGAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014023.2-2614s1c1
Sequence:CCGGGCTGGAATACTGAGTTCAGTTCTCGAGAACTGAACTCAGTATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014023.3-1463s21c1
Sequence:CCGGACAAGTGAGACTGTTTGATATCTCGAGATATCAAACAGTCTCACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014023.3-827s21c1
Sequence:CCGGTGGAGATCAGACTGCTCATATCTCGAGATATGAGCAGTCTGATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172445
WDR37 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 37
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-450s1c1
Sequence:CCGGGCAGAGAAATTGATACTCTTACTCGAGTAAGAGTATCAATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172445.1-926s1c1
Sequence:CCGGGCCGACACTAGTCAACAAATTCTCGAGAATTTGTTGACTAGTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-1751s1c1
Sequence:CCGGGCAGGCTCTTCTGCATATTAACTCGAGTTAATATGCAGAAGAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-2041s1c1
Sequence:CCGGGCATAAACAGTCTGTTACATTCTCGAGAATGTAACAGACTGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-2183s1c1
Sequence:CCGGCGTGCTGTTGTGTAATTTCATCTCGAGATGAAATTACACAACAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-323s1c1
Sequence:CCGGCTGCCAAGAGAAATGTTAGAACTCGAGTTCTAACATTTCTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172445.1-615s1c1
Sequence:CCGGCCAGCTTTAAGACTACCACATCTCGAGATGTGGTAGTCTTAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-1507s1c1
Sequence:CCGGGCAAGTGCGATTGTTTGATATCTCGAGATATCAAACAATCGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172445
WDR37 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 37
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-450s1c1
Sequence:CCGGGCAGAGAAATTGATACTCTTACTCGAGTAAGAGTATCAATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172445.1-926s1c1
Sequence:CCGGGCCGACACTAGTCAACAAATTCTCGAGAATTTGTTGACTAGTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-1751s1c1
Sequence:CCGGGCAGGCTCTTCTGCATATTAACTCGAGTTAATATGCAGAAGAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-2041s1c1
Sequence:CCGGGCATAAACAGTCTGTTACATTCTCGAGAATGTAACAGACTGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-2183s1c1
Sequence:CCGGCGTGCTGTTGTGTAATTTCATCTCGAGATGAAATTACACAACAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-323s1c1
Sequence:CCGGCTGCCAAGAGAAATGTTAGAACTCGAGTTCTAACATTTCTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172445.1-615s1c1
Sequence:CCGGCCAGCTTTAAGACTACCACATCTCGAGATGTGGTAGTCTTAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-1507s1c1
Sequence:CCGGGCAAGTGCGATTGTTTGATATCTCGAGATATCAAACAATCGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172445
WDR37 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 37
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-450s1c1
Sequence:CCGGGCAGAGAAATTGATACTCTTACTCGAGTAAGAGTATCAATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172445.1-926s1c1
Sequence:CCGGGCCGACACTAGTCAACAAATTCTCGAGAATTTGTTGACTAGTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-1751s1c1
Sequence:CCGGGCAGGCTCTTCTGCATATTAACTCGAGTTAATATGCAGAAGAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-2041s1c1
Sequence:CCGGGCATAAACAGTCTGTTACATTCTCGAGAATGTAACAGACTGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172445.1-2183s1c1
Sequence:CCGGCGTGCTGTTGTGTAATTTCATCTCGAGATGAAATTACACAACAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-323s1c1
Sequence:CCGGCTGCCAAGAGAAATGTTAGAACTCGAGTTCTAACATTTCTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172445.1-615s1c1
Sequence:CCGGCCAGCTTTAAGACTACCACATCTCGAGATGTGGTAGTCTTAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172445.1-1507s1c1
Sequence:CCGGGCAAGTGCGATTGTTTGATATCTCGAGATATCAAACAATCGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks