EMAIL THIS PAGE TO A FRIEND

WDR38

WD repeat domain 38

UniProtKB ID: Q5JTN6, A0PK24
Gene ID:
Mouse(76646) WD repeat domain 38
Rat(366035) WD repeat domain 38
cow(787677) WD repeat domain 38
sheep(101107940) WD repeat domain 38
Zebrafish(550366) WD repeat domain 38
domestic cat(101081506) WD repeat domain 38
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001045476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001045476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001045476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120931 MISSION® esiRNA esiRNA human WDR38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001045476 Rosetta Predictions human pricing
XM_001060730 Rosetta Predictions rat pricing
XM_575125 Rosetta Predictions rat pricing
NM_029687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311423 predicted 935
2 SASI_Hs02_00311424 predicted 465
3 SASI_Hs02_00311425 predicted 682
4 SASI_Hs02_00311426 predicted 427
5 SASI_Hs02_00311427 predicted 514
6 SASI_Hs02_00311428 predicted 802
7 SASI_Hs02_00311429 predicted 478
8 SASI_Hs02_00311430 predicted 375
9 SASI_Hs02_00311431 predicted 386
10 SASI_Hs02_00311432 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297538 predicted 262
2 SASI_Rn02_00297539 predicted 769
3 SASI_Rn02_00297540 predicted 684
4 SASI_Rn02_00297541 predicted 302
5 SASI_Rn02_00297542 predicted 411
6 SASI_Rn02_00297543 predicted 981
7 SASI_Rn02_00297544 predicted 860
8 SASI_Rn02_00297545 predicted 299
9 SASI_Rn02_00297546 predicted 919
10 SASI_Rn02_00297547 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403115 predicted 297
2 SASI_Rn02_00403116 predicted 294
3 SASI_Rn02_00403117 predicted 253
4 SASI_Rn02_00403118 predicted 296
5 SASI_Rn02_00403119 predicted 291
6 SASI_Rn02_00403120 predicted 226
7 SASI_Rn02_00403121 predicted 220
8 SASI_Rn02_00403122 predicted 267
9 SASI_Rn02_00403123 predicted 233
10 SASI_Rn02_00403124 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335722 predicted 454
2 SASI_Mm01_00111510 predicted 790
3 SASI_Mm02_00335723 predicted 795
4 SASI_Mm02_00335724 predicted 671
5 SASI_Mm01_00111512 predicted 241
6 SASI_Mm01_00111513 predicted 528
7 SASI_Mm02_00335725 predicted 397
8 SASI_Mm02_00335726 predicted 727
9 SASI_Mm01_00111515 predicted 903
10 SASI_Mm01_00111516 predicted 986
11 SASI_Mm01_00111511 predicted 546
12 SASI_Mm01_00111514 predicted 1047
13 SASI_Mm01_00111517 predicted 1228
14 SASI_Mm01_00111518 predicted 1246
15 SASI_Mm01_00111519 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045476
WDR38 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 38
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-811s21c1
Sequence:CCGGGCTATTCCCGCATGGTCAAAGCTCGAGCTTTGACCATGCGGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-175s21c1
Sequence:CCGGCAGAAGATGGCTGCGTGTATGCTCGAGCATACACGCAGCCATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045476.1-1074s21c1
Sequence:CCGGCAGACGCAAAGTGACTGTGCTCTCGAGAGCACAGTCACTTTGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-941s21c1
Sequence:CCGGCGATCAGACTAGACGTCAAATCTCGAGATTTGACGTCTAGTCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-717s21c1
Sequence:CCGGACAACCAGCAGCCTGCTTATCCTCGAGGATAAGCAGGCTGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045476
WDR38 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 38
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-811s21c1
Sequence:CCGGGCTATTCCCGCATGGTCAAAGCTCGAGCTTTGACCATGCGGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-175s21c1
Sequence:CCGGCAGAAGATGGCTGCGTGTATGCTCGAGCATACACGCAGCCATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045476.1-1074s21c1
Sequence:CCGGCAGACGCAAAGTGACTGTGCTCTCGAGAGCACAGTCACTTTGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-941s21c1
Sequence:CCGGCGATCAGACTAGACGTCAAATCTCGAGATTTGACGTCTAGTCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-717s21c1
Sequence:CCGGACAACCAGCAGCCTGCTTATCCTCGAGGATAAGCAGGCTGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045476
WDR38 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 38
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-811s21c1
Sequence:CCGGGCTATTCCCGCATGGTCAAAGCTCGAGCTTTGACCATGCGGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-175s21c1
Sequence:CCGGCAGAAGATGGCTGCGTGTATGCTCGAGCATACACGCAGCCATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045476.1-1074s21c1
Sequence:CCGGCAGACGCAAAGTGACTGTGCTCTCGAGAGCACAGTCACTTTGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-941s21c1
Sequence:CCGGCGATCAGACTAGACGTCAAATCTCGAGATTTGACGTCTAGTCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045476.1-717s21c1
Sequence:CCGGACAACCAGCAGCCTGCTTATCCTCGAGGATAAGCAGGCTGCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029687
WDR38 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 38
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029687.1-1387s1c1
Sequence:CCGGGCCTTAATCTTGGCCTGCAATCTCGAGATTGCAGGCCAAGATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-920s1c1
Sequence:CCGGCACTGGCAACATCAGTTGTTTCTCGAGAAACAACTGATGTTGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-632s1c1
Sequence:CCGGCAAGTGTCTACATGTGCTGAACTCGAGTTCAGCACATGTAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-1203s1c1
Sequence:CCGGGATGGCAAACTCTTAGTGTCACTCGAGTGACACTAAGAGTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029687
WDR38 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 38
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029687.1-1387s1c1
Sequence:CCGGGCCTTAATCTTGGCCTGCAATCTCGAGATTGCAGGCCAAGATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-920s1c1
Sequence:CCGGCACTGGCAACATCAGTTGTTTCTCGAGAAACAACTGATGTTGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-632s1c1
Sequence:CCGGCAAGTGTCTACATGTGCTGAACTCGAGTTCAGCACATGTAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-1203s1c1
Sequence:CCGGGATGGCAAACTCTTAGTGTCACTCGAGTGACACTAAGAGTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029687
WDR38 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 38
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029687.1-1387s1c1
Sequence:CCGGGCCTTAATCTTGGCCTGCAATCTCGAGATTGCAGGCCAAGATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-920s1c1
Sequence:CCGGCACTGGCAACATCAGTTGTTTCTCGAGAAACAACTGATGTTGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-632s1c1
Sequence:CCGGCAAGTGTCTACATGTGCTGAACTCGAGTTCAGCACATGTAGACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029687.1-1203s1c1
Sequence:CCGGGATGGCAAACTCTTAGTGTCACTCGAGTGACACTAAGAGTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks