EMAIL THIS PAGE TO A FRIEND

WDR3

WD repeat domain 3

Synonyms: DIP2 UTP12
UniProtKB ID: Q9UNX4
Gene ID:
Human(10885) Summary: This gene encodes a nuclear protein containing 10 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, which usually include a trp-asp at the C-terminal end. Proteins belonging to the WD repeat family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Mouse(269470) WD repeat domain 3
Rat(310720) WD repeat domain 3
domestic guinea pig(100724713) WD repeat domain 3
naked mole-rat(101703046) WD repeat domain 3
Domestic Rabbit(100355708) WD repeat domain 3
cow(514870) WD repeat domain 3
sheep(101109229) WD repeat domain 3
Zebrafish(321058) WD repeat domain 3
Horse(100059816) WD repeat domain 3
domestic cat(101090282) WD repeat domain 3
dog(483143) WD repeat domain 3
chicken(427952) WD repeat domain 3
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006784 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082741 MISSION® esiRNA esiRNA human WDR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006784 Rosetta Predictions human pricing
NM_001107705 Rosetta Predictions rat pricing
XM_227527 Rosetta Predictions rat pricing
NM_175552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221936 predicted 1055
2 SASI_Hs02_00342300 predicted 680
3 SASI_Hs01_00221937 predicted 1100
4 SASI_Hs01_00221938 predicted 1320
5 SASI_Hs01_00221940 predicted 826
6 SASI_Hs02_00342301 predicted 1389
7 SASI_Hs02_00342302 predicted 541
8 SASI_Hs02_00342303 predicted 536
9 SASI_Hs01_00221941 predicted 1813
10 SASI_Hs02_00342304 predicted 1438
11 SASI_Hs01_00221932 predicted 2434
12 SASI_Hs01_00221933 predicted 561
13 SASI_Hs01_00221934 predicted 2311
14 SASI_Hs01_00221935 predicted 2551
15 SASI_Hs01_00221939 predicted 2434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231465 predicted 1236
2 SASI_Rn02_00231466 predicted 1097
3 SASI_Rn02_00231467 predicted 2574
4 SASI_Rn02_00231468 predicted 2493
5 SASI_Rn02_00231469 predicted 738
6 SASI_Rn02_00231470 predicted 2401
7 SASI_Rn02_00231471 predicted 1869
8 SASI_Rn02_00231472 predicted 973
9 SASI_Rn02_00231473 predicted 2234
10 SASI_Rn02_00231474 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152085 predicted 1238
2 SASI_Rn01_00152086 predicted 1096
3 SASI_Rn01_00152087 predicted 2568
4 SASI_Rn01_00152088 predicted 419
5 SASI_Rn01_00152089 predicted 739
6 SASI_Rn01_00152090 predicted 2406
7 SASI_Rn01_00152091 predicted 1873
8 SASI_Rn01_00152092 predicted 974
9 SASI_Rn01_00152093 predicted 1541
10 SASI_Rn01_00152094 predicted 2236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094522 predicted 1328
2 SASI_Mm01_00094523 predicted 2571
3 SASI_Mm01_00094526 predicted 2252
4 SASI_Mm01_00094527 predicted 519
5 SASI_Mm01_00094528 predicted 1998
6 SASI_Mm02_00346516 predicted 1344
7 SASI_Mm01_00094529 predicted 2139
8 SASI_Mm01_00094530 predicted 1873
9 SASI_Mm01_00094531 predicted 963
10 SASI_Mm02_00346517 predicted 2054
11 SASI_Mm01_00094524 predicted 871
12 SASI_Mm01_00094525 predicted 2496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175552
VALIDATED
WDR3 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-748s1c1
Sequence:CCGGCAAGAGATTGATGACCCAGAACTCGAGTTCTGGGTCATCAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175552.3-1349s1c1
Sequence:CCGGCGGATAATATAGCTGTGCTTTCTCGAGAAAGCACAGCTATATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-3239s1c1
Sequence:CCGGCGTGTGTGTCATTGTCCTCTACTCGAGTAGAGGACAATGACACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-868s1c1
Sequence:CCGGCGCATACTTTCGTGTAGTAAACTCGAGTTTACTACACGAAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-2697s1c1
Sequence:CCGGGCCCGTGATAGAGAAACTAAACTCGAGTTTAGTTTCTCTATCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175552
VALIDATED
WDR3 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-748s1c1
Sequence:CCGGCAAGAGATTGATGACCCAGAACTCGAGTTCTGGGTCATCAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175552.3-1349s1c1
Sequence:CCGGCGGATAATATAGCTGTGCTTTCTCGAGAAAGCACAGCTATATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-3239s1c1
Sequence:CCGGCGTGTGTGTCATTGTCCTCTACTCGAGTAGAGGACAATGACACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-868s1c1
Sequence:CCGGCGCATACTTTCGTGTAGTAAACTCGAGTTTACTACACGAAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-2697s1c1
Sequence:CCGGGCCCGTGATAGAGAAACTAAACTCGAGTTTAGTTTCTCTATCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175552
VALIDATED
WDR3 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-748s1c1
Sequence:CCGGCAAGAGATTGATGACCCAGAACTCGAGTTCTGGGTCATCAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175552.3-1349s1c1
Sequence:CCGGCGGATAATATAGCTGTGCTTTCTCGAGAAAGCACAGCTATATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-3239s1c1
Sequence:CCGGCGTGTGTGTCATTGTCCTCTACTCGAGTAGAGGACAATGACACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-868s1c1
Sequence:CCGGCGCATACTTTCGTGTAGTAAACTCGAGTTTACTACACGAAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175552.3-2697s1c1
Sequence:CCGGGCCCGTGATAGAGAAACTAAACTCGAGTTTAGTTTCTCTATCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006784
VALIDATED
WDR3 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006784.1-829s1c1
Sequence:CCGGCTGAGGATCGAATCCTTTCATCTCGAGATGAAAGGATTCGATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-771s1c1
Sequence:CCGGCCTGGAATACAAGATACTCTTCTCGAGAAGAGTATCTTGTATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006784.1-339s1c1
Sequence:CCGGGAAGGAAATGTGACCTTCAATCTCGAGATTGAAGGTCACATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-3302s1c1
Sequence:CCGGGTGCATAATTGATTGCCCTTTCTCGAGAAAGGGCAATCAATTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-1524s1c1
Sequence:CCGGGATGCACATGATGGAGCTTTACTCGAGTAAAGCTCCATCATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-279s1c1
Sequence:CCGGCTACACTTAGCTGTTGGGTATCTCGAGATACCCAACAGCTAAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1279s21c1
Sequence:CCGGAGGACAAGCAGAATCACTATTCTCGAGAATAGTGATTCTGCTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-103s21c1
Sequence:CCGGAGTGCGGTCTTTGGCGTTATCCTCGAGGATAACGCCAAAGACCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1123s21c1
Sequence:CCGGATCCAGCGGGTGACTAATATACTCGAGTATATTAGTCACCCGCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1460s21c1
Sequence:CCGGGTGATAGACAGGTAGTCATAGCTCGAGCTATGACTACCTGTCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006784.2-3002s21c1
Sequence:CCGGAGATCGCATTGCAGATGATATCTCGAGATATCATCTGCAATGCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006784
VALIDATED
WDR3 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006784.1-829s1c1
Sequence:CCGGCTGAGGATCGAATCCTTTCATCTCGAGATGAAAGGATTCGATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-771s1c1
Sequence:CCGGCCTGGAATACAAGATACTCTTCTCGAGAAGAGTATCTTGTATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006784.1-339s1c1
Sequence:CCGGGAAGGAAATGTGACCTTCAATCTCGAGATTGAAGGTCACATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-3302s1c1
Sequence:CCGGGTGCATAATTGATTGCCCTTTCTCGAGAAAGGGCAATCAATTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-1524s1c1
Sequence:CCGGGATGCACATGATGGAGCTTTACTCGAGTAAAGCTCCATCATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-279s1c1
Sequence:CCGGCTACACTTAGCTGTTGGGTATCTCGAGATACCCAACAGCTAAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1279s21c1
Sequence:CCGGAGGACAAGCAGAATCACTATTCTCGAGAATAGTGATTCTGCTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-103s21c1
Sequence:CCGGAGTGCGGTCTTTGGCGTTATCCTCGAGGATAACGCCAAAGACCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1123s21c1
Sequence:CCGGATCCAGCGGGTGACTAATATACTCGAGTATATTAGTCACCCGCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1460s21c1
Sequence:CCGGGTGATAGACAGGTAGTCATAGCTCGAGCTATGACTACCTGTCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006784.2-3002s21c1
Sequence:CCGGAGATCGCATTGCAGATGATATCTCGAGATATCATCTGCAATGCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006784
VALIDATED
WDR3 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006784.1-829s1c1
Sequence:CCGGCTGAGGATCGAATCCTTTCATCTCGAGATGAAAGGATTCGATCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-771s1c1
Sequence:CCGGCCTGGAATACAAGATACTCTTCTCGAGAAGAGTATCTTGTATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006784.1-339s1c1
Sequence:CCGGGAAGGAAATGTGACCTTCAATCTCGAGATTGAAGGTCACATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-3302s1c1
Sequence:CCGGGTGCATAATTGATTGCCCTTTCTCGAGAAAGGGCAATCAATTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-1524s1c1
Sequence:CCGGGATGCACATGATGGAGCTTTACTCGAGTAAAGCTCCATCATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006784.1-279s1c1
Sequence:CCGGCTACACTTAGCTGTTGGGTATCTCGAGATACCCAACAGCTAAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1279s21c1
Sequence:CCGGAGGACAAGCAGAATCACTATTCTCGAGAATAGTGATTCTGCTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-103s21c1
Sequence:CCGGAGTGCGGTCTTTGGCGTTATCCTCGAGGATAACGCCAAAGACCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1123s21c1
Sequence:CCGGATCCAGCGGGTGACTAATATACTCGAGTATATTAGTCACCCGCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006784.2-1460s21c1
Sequence:CCGGGTGATAGACAGGTAGTCATAGCTCGAGCTATGACTACCTGTCTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006784.2-3002s21c1
Sequence:CCGGAGATCGCATTGCAGATGATATCTCGAGATATCATCTGCAATGCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks