EMAIL THIS PAGE TO A FRIEND

WDR41

WD repeat domain 41

UniProtKB ID: Q9HAD4, Q7Z792, Q8IWG3, Q8IXA9, Q8NDA7, Q9NV62
Gene ID:
Mouse(218460) WD repeat domain 41
Rat(361879) WD repeat domain 41
naked mole-rat(101714394) WD repeat domain 41
domestic guinea pig(100722961) WD repeat domain 41
cow(514919) WD repeat domain 41
sheep(101112226) WD repeat domain 41
Zebrafish(571294) WD repeat domain 41
Horse(100065484) WD repeat domain 41
domestic cat(101101360) WD repeat domain 41
dog(610498) WD repeat domain 41
chicken(416366) WD repeat domain 41
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018268 Rosetta Predictions human pricing
NM_001108541 Rosetta Predictions rat pricing
NM_172590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169663 predicted 676
2 SASI_Hs01_00169664 predicted 948
3 SASI_Hs01_00169666 predicted 796
4 SASI_Hs01_00169667 predicted 790
5 SASI_Hs01_00169668 predicted 1467
6 SASI_Hs01_00169669 predicted 1293
7 SASI_Hs01_00169670 predicted 470
8 SASI_Hs01_00169671 predicted 1289
9 SASI_Hs01_00169672 predicted 1499
10 SASI_Hs02_00351635 predicted 1477
11 SASI_Hs01_00169665 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239659 predicted 873
2 SASI_Rn02_00239660 predicted 814
3 SASI_Rn02_00239661 predicted 747
4 SASI_Rn02_00239662 predicted 302
5 SASI_Rn02_00239663 predicted 226
6 SASI_Rn02_00239664 predicted 755
7 SASI_Rn02_00239665 predicted 847
8 SASI_Rn02_00239666 predicted 935
9 SASI_Rn02_00239667 predicted 803
10 SASI_Rn02_00239668 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126058 predicted 352
2 SASI_Mm02_00344273 predicted 439
3 SASI_Mm01_00126065 predicted 587
4 SASI_Mm02_00344274 predicted 1182
5 SASI_Mm02_00344275 predicted 1149
6 SASI_Mm02_00344276 predicted 1192
7 SASI_Mm02_00344277 predicted 817
8 SASI_Mm02_00344278 predicted 241
9 SASI_Mm02_00344279 predicted 1091
10 SASI_Mm02_00344280 predicted 372
11 SASI_Mm01_00126057 predicted 674
12 SASI_Mm01_00126059 predicted 384
13 SASI_Mm01_00126060 predicted 1601
14 SASI_Mm01_00126061 predicted 249
15 SASI_Mm01_00126062 predicted 870
16 SASI_Mm01_00126063 predicted 530
17 SASI_Mm01_00126064 predicted 610
18 SASI_Mm01_00126066 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018268
VALIDATED
WDR41 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 41
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1596s21c1
Sequence:CCGGGAATCTGGATTGCGCAGTTTACTCGAGTAAACTGCGCAATCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1199s21c1
Sequence:CCGGATACGTGTATAGCCTTCAAATCTCGAGATTTGAAGGCTATACACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018268.2-1651s21c1
Sequence:CCGGTATACCTTGCTGTCTAGTTTACTCGAGTAAACTAGACAGCAAGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1462s21c1
Sequence:CCGGCATGTTCACTGGAGCTTATTGCTCGAGCAATAAGCTCCAGTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-942s21c1
Sequence:CCGGCTTGATCACCAGGATAATATTCTCGAGAATATTATCCTGGTGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018268.2-1832s21c1
Sequence:CCGGTGCTTCTCAGGTCCTAGTATACTCGAGTATACTAGGACCTGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018268.2-794s1c1
Sequence:CCGGCCACCTTTCTGATACAGGTATCTCGAGATACCTGTATCAGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018268.2-1940s1c1
Sequence:CCGGCCTAGATCCTTGTGAAAGGTACTCGAGTACCTTTCACAAGGATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018268.2-1555s1c1
Sequence:CCGGCCGCTGATCATCTCATTATTTCTCGAGAAATAATGAGATGATCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018268.2-1857s1c1
Sequence:CCGGCCAAAGAATATACCACAAGTTCTCGAGAACTTGTGGTATATTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018268
VALIDATED
WDR41 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 41
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1596s21c1
Sequence:CCGGGAATCTGGATTGCGCAGTTTACTCGAGTAAACTGCGCAATCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1199s21c1
Sequence:CCGGATACGTGTATAGCCTTCAAATCTCGAGATTTGAAGGCTATACACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018268.2-1651s21c1
Sequence:CCGGTATACCTTGCTGTCTAGTTTACTCGAGTAAACTAGACAGCAAGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1462s21c1
Sequence:CCGGCATGTTCACTGGAGCTTATTGCTCGAGCAATAAGCTCCAGTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-942s21c1
Sequence:CCGGCTTGATCACCAGGATAATATTCTCGAGAATATTATCCTGGTGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018268.2-1832s21c1
Sequence:CCGGTGCTTCTCAGGTCCTAGTATACTCGAGTATACTAGGACCTGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018268.2-794s1c1
Sequence:CCGGCCACCTTTCTGATACAGGTATCTCGAGATACCTGTATCAGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018268.2-1940s1c1
Sequence:CCGGCCTAGATCCTTGTGAAAGGTACTCGAGTACCTTTCACAAGGATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018268.2-1555s1c1
Sequence:CCGGCCGCTGATCATCTCATTATTTCTCGAGAAATAATGAGATGATCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018268.2-1857s1c1
Sequence:CCGGCCAAAGAATATACCACAAGTTCTCGAGAACTTGTGGTATATTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018268
VALIDATED
WDR41 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 41
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1596s21c1
Sequence:CCGGGAATCTGGATTGCGCAGTTTACTCGAGTAAACTGCGCAATCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1199s21c1
Sequence:CCGGATACGTGTATAGCCTTCAAATCTCGAGATTTGAAGGCTATACACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018268.2-1651s21c1
Sequence:CCGGTATACCTTGCTGTCTAGTTTACTCGAGTAAACTAGACAGCAAGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-1462s21c1
Sequence:CCGGCATGTTCACTGGAGCTTATTGCTCGAGCAATAAGCTCCAGTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018268.2-942s21c1
Sequence:CCGGCTTGATCACCAGGATAATATTCTCGAGAATATTATCCTGGTGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018268.2-1832s21c1
Sequence:CCGGTGCTTCTCAGGTCCTAGTATACTCGAGTATACTAGGACCTGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018268.2-794s1c1
Sequence:CCGGCCACCTTTCTGATACAGGTATCTCGAGATACCTGTATCAGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018268.2-1940s1c1
Sequence:CCGGCCTAGATCCTTGTGAAAGGTACTCGAGTACCTTTCACAAGGATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018268.2-1555s1c1
Sequence:CCGGCCGCTGATCATCTCATTATTTCTCGAGAAATAATGAGATGATCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018268.2-1857s1c1
Sequence:CCGGCCAAAGAATATACCACAAGTTCTCGAGAACTTGTGGTATATTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172590
WDR41 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 41
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172590.1-1626s1c1
Sequence:CCGGCCGCAGAGTTACAATTAGAATCTCGAGATTCTAATTGTAACTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-374s1c1
Sequence:CCGGGCTGGCGATGATGGAATTATACTCGAGTATAATTCCATCATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-804s1c1
Sequence:CCGGCCACAGAAGAATTGCCGGAATCTCGAGATTCCGGCAATTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-290s1c1
Sequence:CCGGCCCTATACTGAACTGCTGGTACTCGAGTACCAGCAGTTCAGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-859s1c1
Sequence:CCGGCCAGGACAATATTCTGTCATTCTCGAGAATGACAGAATATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172590
WDR41 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 41
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172590.1-1626s1c1
Sequence:CCGGCCGCAGAGTTACAATTAGAATCTCGAGATTCTAATTGTAACTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-374s1c1
Sequence:CCGGGCTGGCGATGATGGAATTATACTCGAGTATAATTCCATCATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-804s1c1
Sequence:CCGGCCACAGAAGAATTGCCGGAATCTCGAGATTCCGGCAATTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-290s1c1
Sequence:CCGGCCCTATACTGAACTGCTGGTACTCGAGTACCAGCAGTTCAGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-859s1c1
Sequence:CCGGCCAGGACAATATTCTGTCATTCTCGAGAATGACAGAATATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172590
WDR41 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 41
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172590.1-1626s1c1
Sequence:CCGGCCGCAGAGTTACAATTAGAATCTCGAGATTCTAATTGTAACTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-374s1c1
Sequence:CCGGGCTGGCGATGATGGAATTATACTCGAGTATAATTCCATCATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-804s1c1
Sequence:CCGGCCACAGAAGAATTGCCGGAATCTCGAGATTCCGGCAATTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-290s1c1
Sequence:CCGGCCCTATACTGAACTGCTGGTACTCGAGTACCAGCAGTTCAGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172590.1-859s1c1
Sequence:CCGGCCAGGACAATATTCTGTCATTCTCGAGAATGACAGAATATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks