EMAIL THIS PAGE TO A FRIEND

WDR43

WD repeat domain 43

Synonyms: NET12 UTP5
UniProtKB ID: Q15061, Q15395, Q92577
Gene ID:
Mouse(72515) WD repeat domain 43
Rat(362703) WD repeat domain 43
Zebrafish(317637) WD repeat domain 43
domestic cat(101092177) WD repeat domain 43
dog(475713) WD repeat domain 43
chicken(421295) WD repeat domain 43
cow(538915) WD repeat domain 43
sheep(101113318) WD repeat domain 43
domestic guinea pig(100728719) WD repeat domain 43
naked mole-rat(101699515) WD repeat domain 43
Domestic Rabbit(100346179) WD repeat domain 43
242 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015131 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015131 Rosetta Predictions human pricing
XM_087089 Rosetta Predictions human pricing
XM_928566 Rosetta Predictions human pricing
XM_932951 Rosetta Predictions human pricing
XM_932955 Rosetta Predictions human pricing
XM_932958 Rosetta Predictions human pricing
NM_001037791 Rosetta Predictions rat pricing
XM_001059356 Rosetta Predictions rat pricing
XM_001061088 Rosetta Predictions rat pricing
XM_001005092 Rosetta Predictions mouse pricing
XM_897701 Rosetta Predictions mouse pricing
XM_897713 Rosetta Predictions mouse pricing
XM_897722 Rosetta Predictions mouse pricing
XM_917905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347045 predicted 395
2 SASI_Hs02_00347046 predicted 1574
3 SASI_Hs02_00347047 predicted 309
4 SASI_Hs02_00347048 predicted 747
5 SASI_Hs02_00347049 predicted 1587
6 SASI_Hs02_00347050 predicted 1400
7 SASI_Hs02_00347051 predicted 414
8 SASI_Hs02_00347052 predicted 1616
9 SASI_Hs02_00347053 predicted 1537
10 SASI_Hs02_00347054 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_087089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257713 predicted 465
2 SASI_Hs01_00257714 predicted 314
3 SASI_Hs01_00257715 predicted 628
4 SASI_Hs01_00257716 predicted 400
5 SASI_Hs01_00257717 predicted 499
6 SASI_Hs01_00257718 predicted 730
7 SASI_Hs01_00257719 predicted 777
8 SASI_Hs01_00257720 predicted 225
9 SASI_Hs01_00257721 predicted 752
10 SASI_Hs01_00257722 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253650 predicted 393
2 SASI_Hs01_00253651 predicted 307
3 SASI_Hs01_00253652 predicted 745
4 SASI_Hs01_00253653 predicted 1399
5 SASI_Hs01_00253654 predicted 414
6 SASI_Hs01_00253655 predicted 1083
7 SASI_Hs01_00253656 predicted 1314
8 SASI_Hs01_00253657 predicted 535
9 SASI_Hs01_00253658 predicted 1293
10 SASI_Hs01_00253659 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289363 predicted 920
2 SASI_Hs01_00289364 predicted 975
3 SASI_Hs01_00289365 predicted 639
4 SASI_Hs01_00289366 predicted 605
5 SASI_Hs01_00289367 predicted 918
6 SASI_Hs01_00289368 predicted 614
7 SASI_Hs01_00289369 predicted 605
8 SASI_Hs01_00289370 predicted 980
9 SASI_Hs01_00289371 predicted 639
10 SASI_Hs01_00289372 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270141 predicted 389
2 SASI_Hs01_00270142 predicted 301
3 SASI_Hs01_00270143 predicted 739
4 SASI_Hs01_00270144 predicted 1397
5 SASI_Hs01_00270145 predicted 409
6 SASI_Hs01_00270146 predicted 1553
7 SASI_Hs01_00270147 predicted 1318
8 SASI_Hs01_00270148 predicted 1289
9 SASI_Hs01_00270149 predicted 1559
10 SASI_Hs01_00270150 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265568 predicted 558
2 SASI_Hs01_00265569 predicted 724
3 SASI_Hs01_00265570 predicted 657
4 SASI_Hs01_00265571 predicted 573
5 SASI_Hs01_00265572 predicted 377
6 SASI_Hs01_00265573 predicted 593
7 SASI_Hs01_00265574 predicted 547
8 SASI_Hs01_00265575 predicted 519
9 SASI_Hs01_00265576 predicted 797
10 SASI_Hs01_00265577 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204609 predicted 745
2 SASI_Rn02_00204610 predicted 280
3 SASI_Rn02_00204611 predicted 1253
4 SASI_Rn02_00204612 predicted 826
5 SASI_Rn02_00204613 predicted 1065
6 SASI_Rn02_00204614 predicted 630
7 SASI_Rn02_00204615 predicted 1824
8 SASI_Rn02_00204616 predicted 1764
9 SASI_Rn02_00204617 predicted 568
10 SASI_Rn02_00204618 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292963 predicted 1847
2 SASI_Rn02_00292964 predicted 2305
3 SASI_Rn02_00292965 predicted 1939
4 SASI_Rn02_00292966 predicted 2230
5 SASI_Rn02_00292967 predicted 2244
6 SASI_Rn02_00292968 predicted 2506
7 SASI_Rn02_00292969 predicted 2351
8 SASI_Rn02_00292970 predicted 2312
9 SASI_Rn02_00292971 predicted 2208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298744 predicted 752
2 SASI_Rn02_00298745 predicted 285
3 SASI_Rn02_00298746 predicted 1258
4 SASI_Rn02_00298747 predicted 826
5 SASI_Rn02_00298748 predicted 1067
6 SASI_Rn02_00298749 predicted 622
7 SASI_Rn02_00298750 predicted 1818
8 SASI_Rn02_00298751 predicted 1761
9 SASI_Rn02_00298752 predicted 565
10 SASI_Rn02_00298753 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356457 predicted 1610
2 SASI_Mm01_00210528 predicted 1664
3 SASI_Mm01_00210530 predicted 594
4 SASI_Mm01_00210532 predicted 745
5 SASI_Mm01_00210533 predicted 1347
6 SASI_Mm01_00210534 predicted 366
7 SASI_Mm01_00210535 predicted 1153
8 SASI_Mm01_00210536 predicted 456
9 SASI_Mm01_00210537 predicted 1113
10 SASI_Mm02_00356458 predicted 546
11 SASI_Mm01_00210529 predicted 1142
12 SASI_Mm01_00210531 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254115 predicted 549
2 SASI_Mm01_00254116 predicted 430
3 SASI_Mm01_00254117 predicted 544
4 SASI_Mm01_00254118 predicted 379
5 SASI_Mm01_00254119 predicted 550
6 SASI_Mm01_00254120 predicted 283
7 SASI_Mm01_00254121 predicted 375
8 SASI_Mm01_00254122 predicted 488
9 SASI_Mm01_00254123 predicted 393
10 SASI_Mm01_00254124 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231918 predicted 1145
2 SASI_Mm01_00231919 predicted 514
3 SASI_Mm01_00231920 predicted 678
4 SASI_Mm01_00231921 predicted 294
5 SASI_Mm01_00231922 predicted 562
6 SASI_Mm01_00231923 predicted 1081
7 SASI_Mm01_00231924 predicted 376
8 SASI_Mm01_00231925 predicted 1044
9 SASI_Mm01_00231926 predicted 977
10 SASI_Mm01_00231927 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227093 predicted 1145
2 SASI_Mm01_00227094 predicted 511
3 SASI_Mm01_00227095 predicted 1441
4 SASI_Mm01_00227096 predicted 673
5 SASI_Mm01_00227097 predicted 1273
6 SASI_Mm01_00227098 predicted 296
7 SASI_Mm01_00227099 predicted 558
8 SASI_Mm01_00227100 predicted 1080
9 SASI_Mm01_00227101 predicted 378
10 SASI_Mm01_00227102 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441525 predicted 1616
2 SASI_Mm02_00441526 predicted 1663
3 SASI_Mm02_00441527 predicted 593
4 SASI_Mm02_00441528 predicted 748
5 SASI_Mm02_00441529 predicted 1347
6 SASI_Mm02_00441530 predicted 367
7 SASI_Mm02_00441531 predicted 1150
8 SASI_Mm02_00441532 predicted 452
9 SASI_Mm02_00441533 predicted 1114
10 SASI_Mm02_00441534 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175639
VALIDATED
WDR43 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 43
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-763s21c1
Sequence:CCGGCGTACACGACCGATTACTTAACTCGAGTTAAGTAATCGGTCGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175639.1-1137s21c1
Sequence:CCGGACTCCAAAGATACTCATATATCTCGAGATATATGAGTATCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-1444s21c1
Sequence:CCGGGGGCTTAGAAAGCAATGATTTCTCGAGAAATCATTGCTTTCTAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175639.1-2524s21c1
Sequence:CCGGTCTTAATCCGGCACGTCTAATCTCGAGATTAGACGTGCCGGATTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-119s21c1
Sequence:CCGGAGTCAAGCCTACTTCGCTTTACTCGAGTAAAGCGAAGTAGGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175639
VALIDATED
WDR43 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 43
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-763s21c1
Sequence:CCGGCGTACACGACCGATTACTTAACTCGAGTTAAGTAATCGGTCGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175639.1-1137s21c1
Sequence:CCGGACTCCAAAGATACTCATATATCTCGAGATATATGAGTATCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-1444s21c1
Sequence:CCGGGGGCTTAGAAAGCAATGATTTCTCGAGAAATCATTGCTTTCTAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175639.1-2524s21c1
Sequence:CCGGTCTTAATCCGGCACGTCTAATCTCGAGATTAGACGTGCCGGATTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-119s21c1
Sequence:CCGGAGTCAAGCCTACTTCGCTTTACTCGAGTAAAGCGAAGTAGGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175639
VALIDATED
WDR43 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 43
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-763s21c1
Sequence:CCGGCGTACACGACCGATTACTTAACTCGAGTTAAGTAATCGGTCGTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175639.1-1137s21c1
Sequence:CCGGACTCCAAAGATACTCATATATCTCGAGATATATGAGTATCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-1444s21c1
Sequence:CCGGGGGCTTAGAAAGCAATGATTTCTCGAGAAATCATTGCTTTCTAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175639.1-2524s21c1
Sequence:CCGGTCTTAATCCGGCACGTCTAATCTCGAGATTAGACGTGCCGGATTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175639.1-119s21c1
Sequence:CCGGAGTCAAGCCTACTTCGCTTTACTCGAGTAAAGCGAAGTAGGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015131
VALIDATED
WDR43 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 43
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015131.1-831s21c1
Sequence:CCGGACCGATGAACCTGTCTATATTCTCGAGAATATAGACAGGTTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015131.1-2742s21c1
Sequence:CCGGACTAGAGAATTAGCCATATTACTCGAGTAATATGGCTAATTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-134s21c1
Sequence:CCGGCGACGGTCACTTACGAGTATGCTCGAGCATACTCGTAAGTGACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-1181s21c1
Sequence:CCGGCAAAGTAGAAACAGCTATAACCTCGAGGTTATAGCTGTTTCTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-752s21c1
Sequence:CCGGAGTACATGACCGGTTACTTAACTCGAGTTAAGTAACCGGTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015131
VALIDATED
WDR43 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 43
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015131.1-831s21c1
Sequence:CCGGACCGATGAACCTGTCTATATTCTCGAGAATATAGACAGGTTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015131.1-2742s21c1
Sequence:CCGGACTAGAGAATTAGCCATATTACTCGAGTAATATGGCTAATTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-134s21c1
Sequence:CCGGCGACGGTCACTTACGAGTATGCTCGAGCATACTCGTAAGTGACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-1181s21c1
Sequence:CCGGCAAAGTAGAAACAGCTATAACCTCGAGGTTATAGCTGTTTCTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-752s21c1
Sequence:CCGGAGTACATGACCGGTTACTTAACTCGAGTTAAGTAACCGGTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015131
VALIDATED
WDR43 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 43
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015131.1-831s21c1
Sequence:CCGGACCGATGAACCTGTCTATATTCTCGAGAATATAGACAGGTTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015131.1-2742s21c1
Sequence:CCGGACTAGAGAATTAGCCATATTACTCGAGTAATATGGCTAATTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-134s21c1
Sequence:CCGGCGACGGTCACTTACGAGTATGCTCGAGCATACTCGTAAGTGACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-1181s21c1
Sequence:CCGGCAAAGTAGAAACAGCTATAACCTCGAGGTTATAGCTGTTTCTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015131.1-752s21c1
Sequence:CCGGAGTACATGACCGGTTACTTAACTCGAGTTAAGTAACCGGTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks