EMAIL THIS PAGE TO A FRIEND

WDR44

WD repeat domain 44

Synonyms: RAB11BP RPH11
Gene ID:
Human(54521) Summary: This gene encodes a protein that interacts with the small GTPase rab11. A similar protein in rat binds the GTP-containing active form of rab11. This protein may play a role in endosome recycling. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(72404) WD repeat domain 44
Rat(246152) WD repeat domain 44
Domestic Rabbit(100353566) WD repeat domain 44
naked mole-rat(101723014) WD repeat domain 44
domestic guinea pig(100731647) WD repeat domain 44
cow(286825) WD repeat domain 44
sheep(101105308) WD repeat domain 44
chicken(422227) WD repeat domain 44
Horse(100053726) WD repeat domain 44
domestic cat(101082133) WD repeat domain 44
dog(481028) WD repeat domain 44
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019045 Rosetta Predictions human pricing
XM_001061437 Rosetta Predictions rat pricing
XM_343761 Rosetta Predictions rat pricing
NM_175180 Rosetta Predictions mouse pricing
XM_135805 Rosetta Predictions mouse pricing
XM_898726 Rosetta Predictions mouse pricing
XM_898737 Rosetta Predictions mouse pricing
XM_898739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239363 predicted 1089
2 SASI_Hs01_00239364 predicted 968
3 SASI_Hs01_00239365 predicted 913
4 SASI_Hs01_00239367 predicted 1728
5 SASI_Hs01_00239368 predicted 2740
6 SASI_Hs01_00239370 predicted 2718
7 SASI_Hs01_00239371 predicted 2021
8 SASI_Hs02_00352615 predicted 2907
9 SASI_Hs02_00352616 predicted 3089
10 SASI_Hs01_00239372 predicted 871
11 SASI_Hs01_00239366 predicted 1793
12 SASI_Hs01_00239369 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300094 predicted 2884
2 SASI_Rn02_00300095 predicted 1369
3 SASI_Rn02_00300096 predicted 1671
4 SASI_Rn02_00300097 predicted 2949
5 SASI_Rn02_00300098 predicted 2365
6 SASI_Rn02_00300099 predicted 2138
7 SASI_Rn02_00300100 predicted 2804
8 SASI_Rn02_00300101 predicted 2060
9 SASI_Rn02_00300102 predicted 2876
10 SASI_Rn02_00300103 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396239 predicted 2884
2 SASI_Rn02_00396240 predicted 1666
3 SASI_Rn02_00396241 predicted 2949
4 SASI_Rn02_00396242 predicted 2368
5 SASI_Rn02_00396243 predicted 2139
6 SASI_Rn02_00396244 predicted 2806
7 SASI_Rn02_00396245 predicted 2062
8 SASI_Rn02_00396246 predicted 2542
9 SASI_Rn02_00396247 predicted 2423
10 SASI_Rn02_00396248 predicted 2876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345829 predicted 812
2 SASI_Mm02_00345830 predicted 2236
3 SASI_Mm02_00345831 predicted 2468
4 SASI_Mm02_00345832 predicted 556
5 SASI_Mm02_00345833 predicted 1713
6 SASI_Mm02_00345834 predicted 2727
7 SASI_Mm02_00345835 predicted 2773
8 SASI_Mm02_00345836 predicted 1481
9 SASI_Mm02_00345837 predicted 2547
10 SASI_Mm02_00345838 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268313 predicted 3058
2 SASI_Mm01_00268314 predicted 883
3 SASI_Mm01_00268315 predicted 1838
4 SASI_Mm01_00268316 predicted 2539
5 SASI_Mm01_00268317 predicted 1787
6 SASI_Mm01_00268318 predicted 2847
7 SASI_Mm01_00268319 predicted 866
8 SASI_Mm01_00268320 predicted 1554
9 SASI_Mm01_00268321 predicted 2614
10 SASI_Mm01_00268322 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278831 predicted 843
2 SASI_Mm01_00278832 predicted 982
3 SASI_Mm01_00278833 predicted 582
4 SASI_Mm01_00278834 predicted 973
5 SASI_Mm01_00278835 predicted 864
6 SASI_Mm01_00278836 predicted 768
7 SASI_Mm01_00278837 predicted 609
8 SASI_Mm01_00278838 predicted 781
9 SASI_Mm01_00278839 predicted 757
10 SASI_Mm01_00278840 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274365 predicted 1375
2 SASI_Mm01_00274366 predicted 1523
3 SASI_Mm01_00274367 predicted 1072
4 SASI_Mm01_00274368 predicted 634
5 SASI_Mm01_00274369 predicted 858
6 SASI_Mm01_00274370 predicted 1108
7 SASI_Mm01_00274371 predicted 1124
8 SASI_Mm01_00274372 predicted 1161
9 SASI_Mm01_00274373 predicted 1034
10 SASI_Mm01_00274374 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279528 predicted 2886
2 SASI_Mm01_00279529 predicted 719
3 SASI_Mm01_00279530 predicted 1673
4 SASI_Mm01_00279531 predicted 2140
5 SASI_Mm01_00279532 predicted 2371
6 SASI_Mm01_00279533 predicted 1623
7 SASI_Mm01_00279534 predicted 2683
8 SASI_Mm01_00279535 predicted 698
9 SASI_Mm01_00279536 predicted 1386
10 SASI_Mm01_00279537 predicted 2451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019045
VALIDATED
WDR44 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 44
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-877s21c1
Sequence:CCGGTAGATGAAACCACGAAGTTAACTCGAGTTAACTTCGTGGTTTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-2761s21c1
Sequence:CCGGAGTATAAGGGTTACGTCAATACTCGAGTATTGACGTAACCCTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-3059s21c1
Sequence:CCGGTGCCACACCTTCTGGTATTATCTCGAGATAATACCAGAAGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019045.3-3552s21c1
Sequence:CCGGTAGTCTTGTTTCTAGCTTAAACTCGAGTTTAAGCTAGAAACAAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-1239s1c1
Sequence:CCGGCCTGATATAGATGTTCCCAAACTCGAGTTTGGGAACATCTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019045.3-1856s1c1
Sequence:CCGGGCCATACACAAGACCAGTTAACTCGAGTTAACTGGTCTTGTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-795s1c1
Sequence:CCGGGCAGAGAGTCAGAATACATTTCTCGAGAAATGTATTCTGACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-1101s1c1
Sequence:CCGGGCTAGTACAAAGAAGCCTGTTCTCGAGAACAGGCTTCTTTGTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-2925s1c1
Sequence:CCGGGAAGGTATTAAAGCCCACAATCTCGAGATTGTGGGCTTTAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019045
VALIDATED
WDR44 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 44
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-877s21c1
Sequence:CCGGTAGATGAAACCACGAAGTTAACTCGAGTTAACTTCGTGGTTTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-2761s21c1
Sequence:CCGGAGTATAAGGGTTACGTCAATACTCGAGTATTGACGTAACCCTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-3059s21c1
Sequence:CCGGTGCCACACCTTCTGGTATTATCTCGAGATAATACCAGAAGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019045.3-3552s21c1
Sequence:CCGGTAGTCTTGTTTCTAGCTTAAACTCGAGTTTAAGCTAGAAACAAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-1239s1c1
Sequence:CCGGCCTGATATAGATGTTCCCAAACTCGAGTTTGGGAACATCTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019045.3-1856s1c1
Sequence:CCGGGCCATACACAAGACCAGTTAACTCGAGTTAACTGGTCTTGTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-795s1c1
Sequence:CCGGGCAGAGAGTCAGAATACATTTCTCGAGAAATGTATTCTGACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-1101s1c1
Sequence:CCGGGCTAGTACAAAGAAGCCTGTTCTCGAGAACAGGCTTCTTTGTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-2925s1c1
Sequence:CCGGGAAGGTATTAAAGCCCACAATCTCGAGATTGTGGGCTTTAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019045
VALIDATED
WDR44 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 44
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-877s21c1
Sequence:CCGGTAGATGAAACCACGAAGTTAACTCGAGTTAACTTCGTGGTTTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-2761s21c1
Sequence:CCGGAGTATAAGGGTTACGTCAATACTCGAGTATTGACGTAACCCTTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019045.3-3059s21c1
Sequence:CCGGTGCCACACCTTCTGGTATTATCTCGAGATAATACCAGAAGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019045.3-3552s21c1
Sequence:CCGGTAGTCTTGTTTCTAGCTTAAACTCGAGTTTAAGCTAGAAACAAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-1239s1c1
Sequence:CCGGCCTGATATAGATGTTCCCAAACTCGAGTTTGGGAACATCTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_019045.3-1856s1c1
Sequence:CCGGGCCATACACAAGACCAGTTAACTCGAGTTAACTGGTCTTGTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-795s1c1
Sequence:CCGGGCAGAGAGTCAGAATACATTTCTCGAGAAATGTATTCTGACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-1101s1c1
Sequence:CCGGGCTAGTACAAAGAAGCCTGTTCTCGAGAACAGGCTTCTTTGTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019045.3-2925s1c1
Sequence:CCGGGAAGGTATTAAAGCCCACAATCTCGAGATTGTGGGCTTTAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175180
WDR44 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1005s21c1
Sequence:CCGGTTACTCCAGAACCTGATATAGCTCGAGCTATATCAGGTTCTGGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175180.2-3923s21c1
Sequence:CCGGGGCTTTGTAAATACCAATATACTCGAGTATATTGGTATTTACAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-2842s21c1
Sequence:CCGGTGACTTCTGGGAAGGTATTAACTCGAGTTAATACCTTCCCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1477s21c1
Sequence:CCGGGAAGTTGCCAACAGGTATTAACTCGAGTTAATACCTGTTGGCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1687s21c1
Sequence:CCGGATATGGTGAACGTGCTATAAACTCGAGTTTATAGCACGTTCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175180
WDR44 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1005s21c1
Sequence:CCGGTTACTCCAGAACCTGATATAGCTCGAGCTATATCAGGTTCTGGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175180.2-3923s21c1
Sequence:CCGGGGCTTTGTAAATACCAATATACTCGAGTATATTGGTATTTACAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-2842s21c1
Sequence:CCGGTGACTTCTGGGAAGGTATTAACTCGAGTTAATACCTTCCCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1477s21c1
Sequence:CCGGGAAGTTGCCAACAGGTATTAACTCGAGTTAATACCTGTTGGCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1687s21c1
Sequence:CCGGATATGGTGAACGTGCTATAAACTCGAGTTTATAGCACGTTCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175180
WDR44 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1005s21c1
Sequence:CCGGTTACTCCAGAACCTGATATAGCTCGAGCTATATCAGGTTCTGGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175180.2-3923s21c1
Sequence:CCGGGGCTTTGTAAATACCAATATACTCGAGTATATTGGTATTTACAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-2842s21c1
Sequence:CCGGTGACTTCTGGGAAGGTATTAACTCGAGTTAATACCTTCCCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1477s21c1
Sequence:CCGGGAAGTTGCCAACAGGTATTAACTCGAGTTAATACCTGTTGGCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175180.2-1687s21c1
Sequence:CCGGATATGGTGAACGTGCTATAAACTCGAGTTTATAGCACGTTCACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks