EMAIL THIS PAGE TO A FRIEND

WDR45

WD repeat domain 45

Synonyms: NBIA4 NBIA5 WDRX1 WIPI-4 WIPI4
Gene ID:
Human(11152) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene has a pseudogene at chromosome 4q31.3. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity and full-length nature of some variants have not been determined. [provided by RefSeq, Jul 2008]
Mouse(54636) WD repeat domain 45
Rat(302559) WD repeat domain 45
Zebrafish(393200) WD repeat domain 45
domestic cat(101100032) WD repeat domain 45
dog(612890) WD repeat domain 45
Horse(100052044) WD repeat domain 45
cow(539190) WD repeat domain 45
sheep(101105885) WD repeat domain 45
domestic guinea pig(100734593) WD repeat domain 45
naked mole-rat(101717202) WD repeat domain 45
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029896 Rosetta Predictions human pricing
NM_007075 Rosetta Predictions human pricing
NM_001013958 Rosetta Predictions rat pricing
NM_172372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095148 predicted 947
2 SASI_Hs01_00095149 predicted 815
3 SASI_Hs01_00095150 predicted 824
4 SASI_Hs01_00095151 predicted 1029
5 SASI_Hs01_00095152 predicted 1218
6 SASI_Hs01_00095153 predicted 646
7 SASI_Hs01_00095154 predicted 1170
8 SASI_Hs01_00095155 predicted 1100
9 SASI_Hs01_00095156 predicted 1131
10 SASI_Hs01_00095157 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206604 predicted 1218
2 SASI_Hs01_00206605 predicted 1078
3 SASI_Hs01_00206606 predicted 1091
4 SASI_Hs01_00206607 predicted 1300
5 SASI_Hs01_00206608 predicted 1479
6 SASI_Hs01_00206609 predicted 919
7 SASI_Hs01_00206610 predicted 1431
8 SASI_Hs01_00206611 predicted 1374
9 SASI_Hs01_00206612 predicted 1400
10 SASI_Hs01_00206613 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115143 predicted 473
2 SASI_Rn01_00115144 predicted 507
3 SASI_Rn02_00201280 predicted 1084
4 SASI_Rn01_00115146 predicted 832
5 SASI_Rn01_00115147 predicted 714
6 SASI_Rn01_00115149 predicted 827
7 SASI_Rn01_00115150 predicted 1030
8 SASI_Rn01_00115151 predicted 455
9 SASI_Rn01_00115152 predicted 974
10 SASI_Rn02_00201281 predicted 986
11 SASI_Rn01_00115145 predicted 1087
12 SASI_Rn01_00115148 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156426 predicted 909
2 SASI_Mm01_00156427 predicted 696
3 SASI_Mm01_00156428 predicted 991
4 SASI_Mm01_00156429 predicted 983
5 SASI_Mm01_00156430 predicted 779
6 SASI_Mm01_00156431 predicted 1092
7 SASI_Mm01_00156432 predicted 781
8 SASI_Mm01_00156433 predicted 535
9 SASI_Mm01_00156434 predicted 675
10 SASI_Mm01_00156435 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172372
VALIDATED
WDR45 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 45
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-506s1c1
Sequence:CCGGCCGCATCTATGTGTACTCCTTCTCGAGAAGGAGTACACATAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-537s1c1
Sequence:CCGGCCAAGAAAGCTGTTTGAGTTTCTCGAGAAACTCAAACAGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172372.1-1348s1c1
Sequence:CCGGGTCTAAATAAACAGCTCGCTTCTCGAGAAGCGAGCTGTTTATTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-924s1c1
Sequence:CCGGGTCCACATCTTCGCTCTTAAACTCGAGTTTAAGAGCGAAGATGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-474s1c1
Sequence:CCGGCGCCATGACAAGATCGTGATTCTCGAGAATCACGATCTTGTCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-506s21c1
Sequence:CCGGCCGCATCTATGTGTACTCCTTCTCGAGAAGGAGTACACATAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-924s21c1
Sequence:CCGGGTCCACATCTTCGCTCTTAAACTCGAGTTTAAGAGCGAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-537s21c1
Sequence:CCGGCCAAGAAAGCTGTTTGAGTTTCTCGAGAAACTCAAACAGCTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-474s21c1
Sequence:CCGGCGCCATGACAAGATCGTGATTCTCGAGAATCACGATCTTGTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172372
VALIDATED
WDR45 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 45
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-506s1c1
Sequence:CCGGCCGCATCTATGTGTACTCCTTCTCGAGAAGGAGTACACATAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-537s1c1
Sequence:CCGGCCAAGAAAGCTGTTTGAGTTTCTCGAGAAACTCAAACAGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172372.1-1348s1c1
Sequence:CCGGGTCTAAATAAACAGCTCGCTTCTCGAGAAGCGAGCTGTTTATTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-924s1c1
Sequence:CCGGGTCCACATCTTCGCTCTTAAACTCGAGTTTAAGAGCGAAGATGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-474s1c1
Sequence:CCGGCGCCATGACAAGATCGTGATTCTCGAGAATCACGATCTTGTCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-506s21c1
Sequence:CCGGCCGCATCTATGTGTACTCCTTCTCGAGAAGGAGTACACATAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-924s21c1
Sequence:CCGGGTCCACATCTTCGCTCTTAAACTCGAGTTTAAGAGCGAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-537s21c1
Sequence:CCGGCCAAGAAAGCTGTTTGAGTTTCTCGAGAAACTCAAACAGCTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-474s21c1
Sequence:CCGGCGCCATGACAAGATCGTGATTCTCGAGAATCACGATCTTGTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172372
VALIDATED
WDR45 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 45
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-506s1c1
Sequence:CCGGCCGCATCTATGTGTACTCCTTCTCGAGAAGGAGTACACATAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-537s1c1
Sequence:CCGGCCAAGAAAGCTGTTTGAGTTTCTCGAGAAACTCAAACAGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172372.1-1348s1c1
Sequence:CCGGGTCTAAATAAACAGCTCGCTTCTCGAGAAGCGAGCTGTTTATTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-924s1c1
Sequence:CCGGGTCCACATCTTCGCTCTTAAACTCGAGTTTAAGAGCGAAGATGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172372.1-474s1c1
Sequence:CCGGCGCCATGACAAGATCGTGATTCTCGAGAATCACGATCTTGTCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-506s21c1
Sequence:CCGGCCGCATCTATGTGTACTCCTTCTCGAGAAGGAGTACACATAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-924s21c1
Sequence:CCGGGTCCACATCTTCGCTCTTAAACTCGAGTTTAAGAGCGAAGATGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-537s21c1
Sequence:CCGGCCAAGAAAGCTGTTTGAGTTTCTCGAGAAACTCAAACAGCTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172372.1-474s21c1
Sequence:CCGGCGCCATGACAAGATCGTGATTCTCGAGAATCACGATCTTGTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007075
VALIDATED
WDR45 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 45
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-1095s1c1
Sequence:CCGGGTCATTGCCATCTGCGTAGATCTCGAGATCTACGCAGATGGCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-1079s1c1
Sequence:CCGGCAAGAACGTCAACTCTGTCATCTCGAGATGACAGAGTTGACGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007075.1-525s1c1
Sequence:CCGGCGAAAGCTGTTTGAGTTTGATCTCGAGATCAAACTCAAACAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-912s1c1
Sequence:CCGGCATATCTTTGCTCTCAAGGATCTCGAGATCCTTGAGAGCAAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-681s1c1
Sequence:CCGGCCATTCACGATCAATGCACATCTCGAGATGTGCATTGATCGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-467s1c1
Sequence:CCGGCAAGATCGTGATCGTGCTGAACTCGAGTTCAGCACGATCACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007075.1-895s1c1
Sequence:CCGGGTGATAAGGGTACTGTCCATACTCGAGTATGGACAGTACCCTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1226s21c1
Sequence:CCGGCATATCTTTGCTCTCAAGGATCTCGAGATCCTTGAGAGCAAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-781s21c1
Sequence:CCGGCAAGATCGTGATCGTGCTGAACTCGAGTTCAGCACGATCACGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1393s21c1
Sequence:CCGGCAAGAACGTCAACTCTGTCATCTCGAGATGACAGAGTTGACGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1409s21c1
Sequence:CCGGGTCATTGCCATCTGCGTAGATCTCGAGATCTACGCAGATGGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007075
VALIDATED
WDR45 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 45
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-1095s1c1
Sequence:CCGGGTCATTGCCATCTGCGTAGATCTCGAGATCTACGCAGATGGCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-1079s1c1
Sequence:CCGGCAAGAACGTCAACTCTGTCATCTCGAGATGACAGAGTTGACGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007075.1-525s1c1
Sequence:CCGGCGAAAGCTGTTTGAGTTTGATCTCGAGATCAAACTCAAACAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-912s1c1
Sequence:CCGGCATATCTTTGCTCTCAAGGATCTCGAGATCCTTGAGAGCAAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-681s1c1
Sequence:CCGGCCATTCACGATCAATGCACATCTCGAGATGTGCATTGATCGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-467s1c1
Sequence:CCGGCAAGATCGTGATCGTGCTGAACTCGAGTTCAGCACGATCACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007075.1-895s1c1
Sequence:CCGGGTGATAAGGGTACTGTCCATACTCGAGTATGGACAGTACCCTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1226s21c1
Sequence:CCGGCATATCTTTGCTCTCAAGGATCTCGAGATCCTTGAGAGCAAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-781s21c1
Sequence:CCGGCAAGATCGTGATCGTGCTGAACTCGAGTTCAGCACGATCACGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1393s21c1
Sequence:CCGGCAAGAACGTCAACTCTGTCATCTCGAGATGACAGAGTTGACGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1409s21c1
Sequence:CCGGGTCATTGCCATCTGCGTAGATCTCGAGATCTACGCAGATGGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007075
VALIDATED
WDR45 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 45
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-1095s1c1
Sequence:CCGGGTCATTGCCATCTGCGTAGATCTCGAGATCTACGCAGATGGCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-1079s1c1
Sequence:CCGGCAAGAACGTCAACTCTGTCATCTCGAGATGACAGAGTTGACGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007075.1-525s1c1
Sequence:CCGGCGAAAGCTGTTTGAGTTTGATCTCGAGATCAAACTCAAACAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-912s1c1
Sequence:CCGGCATATCTTTGCTCTCAAGGATCTCGAGATCCTTGAGAGCAAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-681s1c1
Sequence:CCGGCCATTCACGATCAATGCACATCTCGAGATGTGCATTGATCGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007075.1-467s1c1
Sequence:CCGGCAAGATCGTGATCGTGCTGAACTCGAGTTCAGCACGATCACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007075.1-895s1c1
Sequence:CCGGGTGATAAGGGTACTGTCCATACTCGAGTATGGACAGTACCCTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1226s21c1
Sequence:CCGGCATATCTTTGCTCTCAAGGATCTCGAGATCCTTGAGAGCAAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-781s21c1
Sequence:CCGGCAAGATCGTGATCGTGCTGAACTCGAGTTCAGCACGATCACGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1393s21c1
Sequence:CCGGCAAGAACGTCAACTCTGTCATCTCGAGATGACAGAGTTGACGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007075.3-1409s21c1
Sequence:CCGGGTCATTGCCATCTGCGTAGATCTCGAGATCTACGCAGATGGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks