EMAIL THIS PAGE TO A FRIEND

WDR45B

WD repeat domain 45B

Synonyms: WDR45L WIPI-3 WIPI3
UniProtKB ID: Q5MNZ6, O95328, Q2MCP6, Q6IBN2
Gene ID:
Human(56270) Summary: This gene encodes a member of the WIPI or SVP1 family of WD40 repeat-containing proteins. The protein contains seven WD40 repeats that are thought to fold into a beta-propeller structure that mediates protein-protein interactions, and a conserved motif for interaction with phospholipids. The human genome contains several pseudogenes of this gene. [provided by RefSeq, Jul 2008]
Mouse(66840) WD repeat domain 45B
Rat(360682) WD repeat domain 45B
naked mole-rat(101708147) WD repeat domain 45B
domestic guinea pig(100717342) WD repeat domain 45B
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017886 Anti-WDR45B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2102703 Anti-WDR45L (ab1) antibody produced in rabbit affinity isolated antibody rabbit, horse, mouse, guinea pig, pig, rat, human, bovine
western blot pricing
SAB2102704 Anti-WDR45L (ab2) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, human, horse, rabbit, bovine, pig, mouse, chicken
western blot pricing
SAB2108256 Anti-WDR45L antibody produced in rabbit affinity isolated antibody horse, mouse, human, rabbit, bovine, guinea pig, rat, pig
western blot pricing
SAB2104639 Anti-WDR45L antibody produced in rabbit affinity isolated antibody human, guinea pig, pig, horse, mouse, bovine, zebrafish, rat, rabbit
western blot pricing
SAB2106336 Anti-WDR45L antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019613 Rosetta Predictions human pricing
NM_001039587 Rosetta Predictions rat pricing
NM_025793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127187 predicted 882
2 SASI_Hs01_00127188 predicted 623
3 SASI_Hs02_00352825 predicted 496
4 SASI_Hs01_00127186 predicted 512
5 SASI_Hs02_00352826 predicted 292
6 SASI_Hs01_00127191 predicted 980
7 SASI_Hs01_00127192 predicted 460
8 SASI_Hs02_00352827 predicted 487
9 SASI_Hs01_00127193 predicted 868
10 SASI_Hs01_00127194 predicted 827
11 SASI_Hs01_00127185 predicted 793
12 SASI_Hs01_00127189 predicted 485
13 SASI_Hs01_00127190 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075082 predicted 303
2 SASI_Rn01_00075083 predicted 219
3 SASI_Rn01_00075084 predicted 738
4 SASI_Rn01_00075085 predicted 671
5 SASI_Rn01_00075086 predicted 271
6 SASI_Rn02_00204856 predicted 316
7 SASI_Rn01_00075087 predicted 622
8 SASI_Rn01_00075088 predicted 313
9 SASI_Rn01_00075090 predicted 790
10 SASI_Rn01_00075091 predicted 854
11 SASI_Rn01_00075089 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329035 predicted 307
2 SASI_Mm01_00155697 predicted 421
3 SASI_Mm01_00155701 predicted 282
4 SASI_Mm01_00155703 predicted 854
5 SASI_Mm01_00155704 predicted 286
6 SASI_Mm02_00329036 predicted 329
7 SASI_Mm01_00155705 predicted 439
8 SASI_Mm01_00155706 predicted 337
9 SASI_Mm02_00329037 predicted 901
10 SASI_Mm01_00155698 predicted 427
11 SASI_Mm01_00155699 predicted 754
12 SASI_Mm01_00155700 predicted 301
13 SASI_Mm01_00155702 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019613
VALIDATED
WDR45B MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 45B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019613.3-594s21c1
Sequence:CCGGCGTCTTCGAAACCTGCTATAACTCGAGTTATAGCAGGTTTCGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-2407s21c1
Sequence:CCGGGCCGGTTTCTTTAGTTCTTTACTCGAGTAAAGAACTAAAGAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-1356s21c1
Sequence:CCGGCCATACGTGGTTGTCTGCTTTCTCGAGAAAGCAGACAACCACGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-2031s21c1
Sequence:CCGGGCAGAGTGATGCACGAACTTTCTCGAGAAAGTTCGTGCATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019613.2-2003s1c1
Sequence:CCGGGCAGAGTGATGCACGAACTTTCTCGAGAAAGTTCGTGCATCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019613.2-1114s1c1
Sequence:CCGGGCTACTACAAATTCCTGTTCACTCGAGTGAACAGGAATTTGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019613.2-493s1c1
Sequence:CCGGGAGATAGAATTGTGGTGGTTTCTCGAGAAACCACCACAATTCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019613.2-1328s1c1
Sequence:CCGGCCATACGTGGTTGTCTGCTTTCTCGAGAAAGCAGACAACCACGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019613.2-2253s1c1
Sequence:CCGGGCTCTACATTGTCAGCTACTTCTCGAGAAGTAGCTGACAATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019613.2-520s1c1
Sequence:CCGGCCATGATTAAGGTGTTCACATCTCGAGATGTGAACACCTTAATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019613.2-566s1c1
Sequence:CCGGCGTCTTCGAAACCTGCTATAACTCGAGTTATAGCAGGTTTCGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019613.2-2379s1c1
Sequence:CCGGGCCGGTTTCTTTAGTTCTTTACTCGAGTAAAGAACTAAAGAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019613
VALIDATED
WDR45B MISSION shRNA shRNA Plasmid DNA
WD repeat domain 45B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019613.3-594s21c1
Sequence:CCGGCGTCTTCGAAACCTGCTATAACTCGAGTTATAGCAGGTTTCGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-2407s21c1
Sequence:CCGGGCCGGTTTCTTTAGTTCTTTACTCGAGTAAAGAACTAAAGAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-1356s21c1
Sequence:CCGGCCATACGTGGTTGTCTGCTTTCTCGAGAAAGCAGACAACCACGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-2031s21c1
Sequence:CCGGGCAGAGTGATGCACGAACTTTCTCGAGAAAGTTCGTGCATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019613.2-2003s1c1
Sequence:CCGGGCAGAGTGATGCACGAACTTTCTCGAGAAAGTTCGTGCATCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019613.2-1114s1c1
Sequence:CCGGGCTACTACAAATTCCTGTTCACTCGAGTGAACAGGAATTTGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019613.2-493s1c1
Sequence:CCGGGAGATAGAATTGTGGTGGTTTCTCGAGAAACCACCACAATTCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019613.2-1328s1c1
Sequence:CCGGCCATACGTGGTTGTCTGCTTTCTCGAGAAAGCAGACAACCACGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019613.2-2253s1c1
Sequence:CCGGGCTCTACATTGTCAGCTACTTCTCGAGAAGTAGCTGACAATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019613.2-520s1c1
Sequence:CCGGCCATGATTAAGGTGTTCACATCTCGAGATGTGAACACCTTAATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019613.2-566s1c1
Sequence:CCGGCGTCTTCGAAACCTGCTATAACTCGAGTTATAGCAGGTTTCGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019613.2-2379s1c1
Sequence:CCGGGCCGGTTTCTTTAGTTCTTTACTCGAGTAAAGAACTAAAGAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019613
VALIDATED
WDR45B MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 45B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019613.3-594s21c1
Sequence:CCGGCGTCTTCGAAACCTGCTATAACTCGAGTTATAGCAGGTTTCGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-2407s21c1
Sequence:CCGGGCCGGTTTCTTTAGTTCTTTACTCGAGTAAAGAACTAAAGAAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-1356s21c1
Sequence:CCGGCCATACGTGGTTGTCTGCTTTCTCGAGAAAGCAGACAACCACGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019613.3-2031s21c1
Sequence:CCGGGCAGAGTGATGCACGAACTTTCTCGAGAAAGTTCGTGCATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019613.2-2003s1c1
Sequence:CCGGGCAGAGTGATGCACGAACTTTCTCGAGAAAGTTCGTGCATCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019613.2-1114s1c1
Sequence:CCGGGCTACTACAAATTCCTGTTCACTCGAGTGAACAGGAATTTGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019613.2-493s1c1
Sequence:CCGGGAGATAGAATTGTGGTGGTTTCTCGAGAAACCACCACAATTCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019613.2-1328s1c1
Sequence:CCGGCCATACGTGGTTGTCTGCTTTCTCGAGAAAGCAGACAACCACGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019613.2-2253s1c1
Sequence:CCGGGCTCTACATTGTCAGCTACTTCTCGAGAAGTAGCTGACAATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019613.2-520s1c1
Sequence:CCGGCCATGATTAAGGTGTTCACATCTCGAGATGTGAACACCTTAATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019613.2-566s1c1
Sequence:CCGGCGTCTTCGAAACCTGCTATAACTCGAGTTATAGCAGGTTTCGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019613.2-2379s1c1
Sequence:CCGGGCCGGTTTCTTTAGTTCTTTACTCGAGTAAAGAACTAAAGAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025793
VALIDATED
WDR45B MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 45B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-287s1c1
Sequence:CCGGGAAATGTTATTTCGCTGTAACCTCGAGGTTACAGCGAAATAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-472s1c1
Sequence:CCGGGATTAAGGTGTTCACGTTCACCTCGAGGTGAACGTGAACACCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-385s1c1
Sequence:CCGGGAAGACAGTCATCGAGATAGACTCGAGTCTATCTCGATGACTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025793.2-1933s21c1
Sequence:CCGGCCATAGGAACACACTAACATTCTCGAGAATGTTAGTGTGTTCCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-792s21c1
Sequence:CCGGGAGGATCTCAAGCAGCCAATACTCGAGTATTGGCTGCTTGAGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-436s21c1
Sequence:CCGGGCGGAGAGATAGAATTGTGGTCTCGAGACCACAATTCTATCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-514s21c1
Sequence:CCGGCGTCTTTGAAACCTGCTACAACTCGAGTTGTAGCAGGTTTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025793.1-1301s1c1
Sequence:CCGGGCAAGGCTTCTCATCCCATATCTCGAGATATGGGATGAGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-514s1c1
Sequence:CCGGCGTCTTTGAAACCTGCTACAACTCGAGTTGTAGCAGGTTTCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025793.1-436s1c1
Sequence:CCGGGCGGAGAGATAGAATTGTGGTCTCGAGACCACAATTCTATCTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-1933s1c1
Sequence:CCGGCCATAGGAACACACTAACATTCTCGAGAATGTTAGTGTGTTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-792s1c1
Sequence:CCGGGAGGATCTCAAGCAGCCAATACTCGAGTATTGGCTGCTTGAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025793
VALIDATED
WDR45B MISSION shRNA shRNA Plasmid DNA
WD repeat domain 45B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-287s1c1
Sequence:CCGGGAAATGTTATTTCGCTGTAACCTCGAGGTTACAGCGAAATAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-472s1c1
Sequence:CCGGGATTAAGGTGTTCACGTTCACCTCGAGGTGAACGTGAACACCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-385s1c1
Sequence:CCGGGAAGACAGTCATCGAGATAGACTCGAGTCTATCTCGATGACTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025793.2-1933s21c1
Sequence:CCGGCCATAGGAACACACTAACATTCTCGAGAATGTTAGTGTGTTCCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-792s21c1
Sequence:CCGGGAGGATCTCAAGCAGCCAATACTCGAGTATTGGCTGCTTGAGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-436s21c1
Sequence:CCGGGCGGAGAGATAGAATTGTGGTCTCGAGACCACAATTCTATCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-514s21c1
Sequence:CCGGCGTCTTTGAAACCTGCTACAACTCGAGTTGTAGCAGGTTTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025793.1-1301s1c1
Sequence:CCGGGCAAGGCTTCTCATCCCATATCTCGAGATATGGGATGAGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-514s1c1
Sequence:CCGGCGTCTTTGAAACCTGCTACAACTCGAGTTGTAGCAGGTTTCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025793.1-436s1c1
Sequence:CCGGGCGGAGAGATAGAATTGTGGTCTCGAGACCACAATTCTATCTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-1933s1c1
Sequence:CCGGCCATAGGAACACACTAACATTCTCGAGAATGTTAGTGTGTTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-792s1c1
Sequence:CCGGGAGGATCTCAAGCAGCCAATACTCGAGTATTGGCTGCTTGAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025793
VALIDATED
WDR45B MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 45B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-287s1c1
Sequence:CCGGGAAATGTTATTTCGCTGTAACCTCGAGGTTACAGCGAAATAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-472s1c1
Sequence:CCGGGATTAAGGTGTTCACGTTCACCTCGAGGTGAACGTGAACACCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025793.2-385s1c1
Sequence:CCGGGAAGACAGTCATCGAGATAGACTCGAGTCTATCTCGATGACTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025793.2-1933s21c1
Sequence:CCGGCCATAGGAACACACTAACATTCTCGAGAATGTTAGTGTGTTCCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-792s21c1
Sequence:CCGGGAGGATCTCAAGCAGCCAATACTCGAGTATTGGCTGCTTGAGATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-436s21c1
Sequence:CCGGGCGGAGAGATAGAATTGTGGTCTCGAGACCACAATTCTATCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025793.2-514s21c1
Sequence:CCGGCGTCTTTGAAACCTGCTACAACTCGAGTTGTAGCAGGTTTCAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025793.1-1301s1c1
Sequence:CCGGGCAAGGCTTCTCATCCCATATCTCGAGATATGGGATGAGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-514s1c1
Sequence:CCGGCGTCTTTGAAACCTGCTACAACTCGAGTTGTAGCAGGTTTCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025793.1-436s1c1
Sequence:CCGGGCGGAGAGATAGAATTGTGGTCTCGAGACCACAATTCTATCTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-1933s1c1
Sequence:CCGGCCATAGGAACACACTAACATTCTCGAGAATGTTAGTGTGTTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025793.1-792s1c1
Sequence:CCGGGAGGATCTCAAGCAGCCAATACTCGAGTATTGGCTGCTTGAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks