EMAIL THIS PAGE TO A FRIEND

WDR46

WD repeat domain 46

Synonyms: BING4 C6orf11 FP221 UTP7
UniProtKB ID: O15213, A6NDP5, Q5HYZ0, Q5STK5, Q5STR3
Gene ID:
Mouse(57315) WD repeat domain 46
Rat(309628) WD repeat domain 46
Zebrafish(393596) WD repeat domain 46
Horse(100052757) WD repeat domain 46
domestic cat(101087740) WD repeat domain 46
dog(481738) WD repeat domain 46
cow(509913) WD repeat domain 46
sheep(101112007) WD repeat domain 46
domestic guinea pig(100731119) WD repeat domain 46
naked mole-rat(101721463) WD repeat domain 46
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005452 Rosetta Predictions human pricing
NM_212491 Rosetta Predictions rat pricing
NM_020603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021480 predicted 546
2 SASI_Hs01_00021481 predicted 832
3 SASI_Hs01_00021482 predicted 564
4 SASI_Hs01_00021483 predicted 1636
5 SASI_Hs01_00021484 predicted 398
6 SASI_Hs01_00021485 predicted 1020
7 SASI_Hs01_00021486 predicted 626
8 SASI_Hs01_00021487 predicted 1059
9 SASI_Hs01_00021488 predicted 1649
10 SASI_Hs01_00021489 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107945 predicted 814
2 SASI_Rn01_00107946 predicted 718
3 SASI_Rn01_00107947 predicted 383
4 SASI_Rn01_00107948 predicted 564
5 SASI_Rn01_00107949 predicted 1066
6 SASI_Rn01_00107950 predicted 1501
7 SASI_Rn01_00107951 predicted 1805
8 SASI_Rn02_00270471 predicted 1776
9 SASI_Rn01_00107953 predicted 1028
10 SASI_Rn01_00107954 predicted 1048
11 SASI_Rn01_00107952 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085204 predicted 775
2 SASI_Mm01_00085205 predicted 572
3 SASI_Mm01_00085206 predicted 680
4 SASI_Mm01_00085207 predicted 1025
5 SASI_Mm01_00085208 predicted 209
6 SASI_Mm01_00085209 predicted 1612
7 SASI_Mm01_00085210 predicted 992
8 SASI_Mm01_00085211 predicted 764
9 SASI_Mm01_00085212 predicted 1012
10 SASI_Mm02_00325708 predicted 529
11 SASI_Mm01_00085213 predicted 1710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020603
VALIDATED
WDR46 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 46
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020603.2-1828s1c1
Sequence:CCGGGCACTGGATAGATTTGTACGACTCGAGTCGTACAAATCTATCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020603.2-1155s1c1
Sequence:CCGGCCAGCTGAAGATCTTTGACTTCTCGAGAAGTCAAAGATCTTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1151s21c1
Sequence:CCGGACCACCAGCTGAAGATCTTTGCTCGAGCAAAGATCTTCAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020603.2-601s21c1
Sequence:CCGGGGACCCTACAGACTGAATTACCTCGAGGTAATTCAGTCTGTAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-2065s21c1
Sequence:CCGGCACAAAGATCCATAGGGAAATCTCGAGATTTCCCTATGGATCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1268s21c1
Sequence:CCGGTGGGTGATGTGGTCAACATATCTCGAGATATGTTGACCACATCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1021s21c1
Sequence:CCGGAGTAATGGCACAGTGTCTTTACTCGAGTAAAGACACTGTGCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020603
VALIDATED
WDR46 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 46
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020603.2-1828s1c1
Sequence:CCGGGCACTGGATAGATTTGTACGACTCGAGTCGTACAAATCTATCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020603.2-1155s1c1
Sequence:CCGGCCAGCTGAAGATCTTTGACTTCTCGAGAAGTCAAAGATCTTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1151s21c1
Sequence:CCGGACCACCAGCTGAAGATCTTTGCTCGAGCAAAGATCTTCAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020603.2-601s21c1
Sequence:CCGGGGACCCTACAGACTGAATTACCTCGAGGTAATTCAGTCTGTAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-2065s21c1
Sequence:CCGGCACAAAGATCCATAGGGAAATCTCGAGATTTCCCTATGGATCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1268s21c1
Sequence:CCGGTGGGTGATGTGGTCAACATATCTCGAGATATGTTGACCACATCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1021s21c1
Sequence:CCGGAGTAATGGCACAGTGTCTTTACTCGAGTAAAGACACTGTGCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020603
VALIDATED
WDR46 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 46
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020603.2-1828s1c1
Sequence:CCGGGCACTGGATAGATTTGTACGACTCGAGTCGTACAAATCTATCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020603.2-1155s1c1
Sequence:CCGGCCAGCTGAAGATCTTTGACTTCTCGAGAAGTCAAAGATCTTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1151s21c1
Sequence:CCGGACCACCAGCTGAAGATCTTTGCTCGAGCAAAGATCTTCAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020603.2-601s21c1
Sequence:CCGGGGACCCTACAGACTGAATTACCTCGAGGTAATTCAGTCTGTAGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-2065s21c1
Sequence:CCGGCACAAAGATCCATAGGGAAATCTCGAGATTTCCCTATGGATCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1268s21c1
Sequence:CCGGTGGGTGATGTGGTCAACATATCTCGAGATATGTTGACCACATCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020603.2-1021s21c1
Sequence:CCGGAGTAATGGCACAGTGTCTTTACTCGAGTAAAGACACTGTGCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005452
VALIDATED
WDR46 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 46
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-612s1c1
Sequence:CCGGGACTTGAATCTGCGGCAGTTTCTCGAGAAACTGCCGCAGATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-922s1c1
Sequence:CCGGCTTCAGAAACAGGGTTTCTAACTCGAGTTAGAAACCCTGTTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-1500s1c1
Sequence:CCGGCTGGAGAGTAATCCATACAGACTCGAGTCTGTATGGATTACTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1054s1c1
Sequence:CCGGGCAATGGTACTGTGTCTTTATCTCGAGATAAAGACACAGTACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-374s1c1
Sequence:CCGGGAAGTTCTGTCGCATTGACAACTCGAGTTGTCAATGCGACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1914s1c1
Sequence:CCGGCAAGATCACCTGTAGGGAAATCTCGAGATTTCCCTACAGGTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1019s1c1
Sequence:CCGGGAACCCTTACAATGCCGTCATCTCGAGATGACGGCATTGTAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005452.4-469s1c1
Sequence:CCGGCAAGTATCAAAGCTGCTCGTTCTCGAGAACGAGCAGCTTTGATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-1492s21c1
Sequence:CCGGTCGATGGCCTGGAGAGTAATCCTCGAGGATTACTCTCCAGGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-1914s21c1
Sequence:CCGGCAAGATCACCTGTAGGGAAATCTCGAGATTTCCCTACAGGTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-395s21c1
Sequence:CCGGATCCCGAAAGCTACCACATTCCTCGAGGAATGTGGTAGCTTTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-612s21c1
Sequence:CCGGGACTTGAATCTGCGGCAGTTTCTCGAGAAACTGCCGCAGATTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005452.4-695s21c1
Sequence:CCGGTCATGTGGCTGCCCTTGATTGCTCGAGCAATCAAGGGCAGCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005452
VALIDATED
WDR46 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 46
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-612s1c1
Sequence:CCGGGACTTGAATCTGCGGCAGTTTCTCGAGAAACTGCCGCAGATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-922s1c1
Sequence:CCGGCTTCAGAAACAGGGTTTCTAACTCGAGTTAGAAACCCTGTTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-1500s1c1
Sequence:CCGGCTGGAGAGTAATCCATACAGACTCGAGTCTGTATGGATTACTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1054s1c1
Sequence:CCGGGCAATGGTACTGTGTCTTTATCTCGAGATAAAGACACAGTACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-374s1c1
Sequence:CCGGGAAGTTCTGTCGCATTGACAACTCGAGTTGTCAATGCGACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1914s1c1
Sequence:CCGGCAAGATCACCTGTAGGGAAATCTCGAGATTTCCCTACAGGTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1019s1c1
Sequence:CCGGGAACCCTTACAATGCCGTCATCTCGAGATGACGGCATTGTAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005452.4-469s1c1
Sequence:CCGGCAAGTATCAAAGCTGCTCGTTCTCGAGAACGAGCAGCTTTGATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-1492s21c1
Sequence:CCGGTCGATGGCCTGGAGAGTAATCCTCGAGGATTACTCTCCAGGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-1914s21c1
Sequence:CCGGCAAGATCACCTGTAGGGAAATCTCGAGATTTCCCTACAGGTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-395s21c1
Sequence:CCGGATCCCGAAAGCTACCACATTCCTCGAGGAATGTGGTAGCTTTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-612s21c1
Sequence:CCGGGACTTGAATCTGCGGCAGTTTCTCGAGAAACTGCCGCAGATTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005452.4-695s21c1
Sequence:CCGGTCATGTGGCTGCCCTTGATTGCTCGAGCAATCAAGGGCAGCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005452
VALIDATED
WDR46 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 46
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-612s1c1
Sequence:CCGGGACTTGAATCTGCGGCAGTTTCTCGAGAAACTGCCGCAGATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-922s1c1
Sequence:CCGGCTTCAGAAACAGGGTTTCTAACTCGAGTTAGAAACCCTGTTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-1500s1c1
Sequence:CCGGCTGGAGAGTAATCCATACAGACTCGAGTCTGTATGGATTACTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1054s1c1
Sequence:CCGGGCAATGGTACTGTGTCTTTATCTCGAGATAAAGACACAGTACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005452.4-374s1c1
Sequence:CCGGGAAGTTCTGTCGCATTGACAACTCGAGTTGTCAATGCGACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1914s1c1
Sequence:CCGGCAAGATCACCTGTAGGGAAATCTCGAGATTTCCCTACAGGTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005452.4-1019s1c1
Sequence:CCGGGAACCCTTACAATGCCGTCATCTCGAGATGACGGCATTGTAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005452.4-469s1c1
Sequence:CCGGCAAGTATCAAAGCTGCTCGTTCTCGAGAACGAGCAGCTTTGATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-1492s21c1
Sequence:CCGGTCGATGGCCTGGAGAGTAATCCTCGAGGATTACTCTCCAGGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-1914s21c1
Sequence:CCGGCAAGATCACCTGTAGGGAAATCTCGAGATTTCCCTACAGGTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-395s21c1
Sequence:CCGGATCCCGAAAGCTACCACATTCCTCGAGGAATGTGGTAGCTTTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005452.4-612s21c1
Sequence:CCGGGACTTGAATCTGCGGCAGTTTCTCGAGAAACTGCCGCAGATTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005452.4-695s21c1
Sequence:CCGGTCATGTGGCTGCCCTTGATTGCTCGAGCAATCAAGGGCAGCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks