EMAIL THIS PAGE TO A FRIEND

WDR47

WD repeat domain 47

Gene ID:
Mouse(99512) WD repeat domain 47
Rat(310785) WD repeat domain 47
naked mole-rat(101722800) WD repeat domain 47
Domestic Rabbit(100340673) WD repeat domain 47
domestic guinea pig(100728010) WD repeat domain 47
cow(512354) WD repeat domain 47
sheep(101123336) WD repeat domain 47
chicken(424344) WD repeat domain 47
Horse(100061070) WD repeat domain 47
domestic cat(101096824) WD repeat domain 47
dog(490126) WD repeat domain 47
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014969 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014969 Rosetta Predictions human pricing
XM_001071369 Rosetta Predictions rat pricing
XM_001081957 Rosetta Predictions rat pricing
XM_227587 Rosetta Predictions rat pricing
NM_181400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182513 predicted 943
2 SASI_Hs01_00182515 predicted 2719
3 SASI_Hs01_00182516 predicted 420
4 SASI_Hs02_00346677 predicted 2926
5 SASI_Hs01_00182518 predicted 1171
6 SASI_Hs02_00346678 predicted 1327
7 SASI_Hs02_00346679 predicted 1787
8 SASI_Hs02_00346680 predicted 1869
9 SASI_Hs01_00182521 predicted 1218
10 SASI_Hs01_00182522 predicted 2354
11 SASI_Hs01_00182514 predicted 2243
12 SASI_Hs01_00182517 predicted 3065
13 SASI_Hs01_00182519 predicted 1116
14 SASI_Hs01_00182520 predicted 2699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334845 predicted 1528
2 SASI_Rn02_00334846 predicted 1964
3 SASI_Rn02_00334847 predicted 1179
4 SASI_Rn02_00334848 predicted 1016
5 SASI_Rn02_00334849 predicted 1630
6 SASI_Rn02_00334850 predicted 2026
7 SASI_Rn02_00334851 predicted 1290
8 SASI_Rn02_00334852 predicted 1757
9 SASI_Rn02_00334853 predicted 1046
10 SASI_Rn02_00334854 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374231 predicted 1523
2 SASI_Rn02_00374232 predicted 1958
3 SASI_Rn02_00374233 predicted 1174
4 SASI_Rn02_00374234 predicted 1017
5 SASI_Rn02_00374235 predicted 1634
6 SASI_Rn02_00374236 predicted 2030
7 SASI_Rn02_00374237 predicted 1290
8 SASI_Rn02_00374238 predicted 1759
9 SASI_Rn02_00374239 predicted 1041
10 SASI_Rn02_00374240 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174366 predicted 2053
2 SASI_Rn01_00174367 predicted 1149
3 SASI_Rn01_00174368 predicted 984
4 SASI_Rn01_00174369 predicted 2401
5 SASI_Rn01_00174370 predicted 1727
6 SASI_Rn01_00174371 predicted 2127
7 SASI_Rn01_00174372 predicted 1263
8 SASI_Rn01_00174373 predicted 860
9 SASI_Rn01_00174374 predicted 1849
10 SASI_Rn01_00174375 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118622 predicted 2249
2 SASI_Mm02_00349738 predicted 1667
3 SASI_Mm01_00118623 predicted 3136
4 SASI_Mm01_00118624 predicted 897
5 SASI_Mm01_00118625 predicted 1011
6 SASI_Mm01_00118627 predicted 2457
7 SASI_Mm01_00118628 predicted 1941
8 SASI_Mm01_00118629 predicted 1045
9 SASI_Mm01_00118630 predicted 913
10 SASI_Mm02_00349739 predicted 1792
11 SASI_Mm01_00118626 predicted 1887
12 SASI_Mm01_00118631 predicted 1824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014969
WDR47 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 47
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-2353s21c1
Sequence:CCGGACATCATAAAGGATCCATTTACTCGAGTAAATGGATCCTTTATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-940s21c1
Sequence:CCGGGGCTAGTAACAATCGTTTATTCTCGAGAATAAACGATTGTTACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-1342s21c1
Sequence:CCGGTGGACTAACCAGTCATGATAACTCGAGTTATCATGACTGGTTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-2387s21c1
Sequence:CCGGAGTCCTTGTGGGCAGTTATTACTCGAGTAATAACTGCCCACAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1490s1c1
Sequence:CCGGCAGGACCAGCTAAACAAGAAACTCGAGTTTCTTGTTTAGCTGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014969.3-3449s1c1
Sequence:CCGGCCCAGGTGTTCAGAATTACTTCTCGAGAAGTAATTCTGAACACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1768s1c1
Sequence:CCGGCAGCAATGTAATGGGAGCAAACTCGAGTTTGCTCCCATTACATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-2630s1c1
Sequence:CCGGCTCGTGTTGTTGGCACAACATCTCGAGATGTTGTGCCAACAACACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1127s1c1
Sequence:CCGGGCAAACTCTCTCCCTATCCATCTCGAGATGGATAGGGAGAGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-1602s1c1
Sequence:CCGGGCGGCAGATATACCAACAGATCTCGAGATCTGTTGGTATATCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-454s1c1
Sequence:CCGGCTTCAGTTCATTCAGCCTCTACTCGAGTAGAGGCTGAATGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-2711s1c1
Sequence:CCGGCCACAGGTCAAGAAGATTCTACTCGAGTAGAATCTTCTTGACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-709s1c1
Sequence:CCGGGCCGAGTTTAAGGACTGGAATCTCGAGATTCCAGTCCTTAAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-793s1c1
Sequence:CCGGGCTGATAGGAAGCTAAGTGAACTCGAGTTCACTTAGCTTCCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-2583s1c1
Sequence:CCGGCCAAGATAAGACTGTTGGATTCTCGAGAATCCAACAGTCTTATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1668s1c1
Sequence:CCGGGCAGAATCTTACTGAACAGTTCTCGAGAACTGTTCAGTAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014969.3-3450s1c1
Sequence:CCGGCCAGGTGTTCAGAATTACTTTCTCGAGAAAGTAATTCTGAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014969
WDR47 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 47
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-2353s21c1
Sequence:CCGGACATCATAAAGGATCCATTTACTCGAGTAAATGGATCCTTTATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-940s21c1
Sequence:CCGGGGCTAGTAACAATCGTTTATTCTCGAGAATAAACGATTGTTACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-1342s21c1
Sequence:CCGGTGGACTAACCAGTCATGATAACTCGAGTTATCATGACTGGTTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-2387s21c1
Sequence:CCGGAGTCCTTGTGGGCAGTTATTACTCGAGTAATAACTGCCCACAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1490s1c1
Sequence:CCGGCAGGACCAGCTAAACAAGAAACTCGAGTTTCTTGTTTAGCTGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014969.3-3449s1c1
Sequence:CCGGCCCAGGTGTTCAGAATTACTTCTCGAGAAGTAATTCTGAACACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1768s1c1
Sequence:CCGGCAGCAATGTAATGGGAGCAAACTCGAGTTTGCTCCCATTACATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-2630s1c1
Sequence:CCGGCTCGTGTTGTTGGCACAACATCTCGAGATGTTGTGCCAACAACACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1127s1c1
Sequence:CCGGGCAAACTCTCTCCCTATCCATCTCGAGATGGATAGGGAGAGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-1602s1c1
Sequence:CCGGGCGGCAGATATACCAACAGATCTCGAGATCTGTTGGTATATCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-454s1c1
Sequence:CCGGCTTCAGTTCATTCAGCCTCTACTCGAGTAGAGGCTGAATGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-2711s1c1
Sequence:CCGGCCACAGGTCAAGAAGATTCTACTCGAGTAGAATCTTCTTGACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-709s1c1
Sequence:CCGGGCCGAGTTTAAGGACTGGAATCTCGAGATTCCAGTCCTTAAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-793s1c1
Sequence:CCGGGCTGATAGGAAGCTAAGTGAACTCGAGTTCACTTAGCTTCCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-2583s1c1
Sequence:CCGGCCAAGATAAGACTGTTGGATTCTCGAGAATCCAACAGTCTTATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1668s1c1
Sequence:CCGGGCAGAATCTTACTGAACAGTTCTCGAGAACTGTTCAGTAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014969.3-3450s1c1
Sequence:CCGGCCAGGTGTTCAGAATTACTTTCTCGAGAAAGTAATTCTGAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014969
WDR47 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 47
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-2353s21c1
Sequence:CCGGACATCATAAAGGATCCATTTACTCGAGTAAATGGATCCTTTATGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-940s21c1
Sequence:CCGGGGCTAGTAACAATCGTTTATTCTCGAGAATAAACGATTGTTACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-1342s21c1
Sequence:CCGGTGGACTAACCAGTCATGATAACTCGAGTTATCATGACTGGTTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014969.5-2387s21c1
Sequence:CCGGAGTCCTTGTGGGCAGTTATTACTCGAGTAATAACTGCCCACAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1490s1c1
Sequence:CCGGCAGGACCAGCTAAACAAGAAACTCGAGTTTCTTGTTTAGCTGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014969.3-3449s1c1
Sequence:CCGGCCCAGGTGTTCAGAATTACTTCTCGAGAAGTAATTCTGAACACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1768s1c1
Sequence:CCGGCAGCAATGTAATGGGAGCAAACTCGAGTTTGCTCCCATTACATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-2630s1c1
Sequence:CCGGCTCGTGTTGTTGGCACAACATCTCGAGATGTTGTGCCAACAACACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1127s1c1
Sequence:CCGGGCAAACTCTCTCCCTATCCATCTCGAGATGGATAGGGAGAGAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-1602s1c1
Sequence:CCGGGCGGCAGATATACCAACAGATCTCGAGATCTGTTGGTATATCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-454s1c1
Sequence:CCGGCTTCAGTTCATTCAGCCTCTACTCGAGTAGAGGCTGAATGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-2711s1c1
Sequence:CCGGCCACAGGTCAAGAAGATTCTACTCGAGTAGAATCTTCTTGACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-709s1c1
Sequence:CCGGGCCGAGTTTAAGGACTGGAATCTCGAGATTCCAGTCCTTAAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014969.3-793s1c1
Sequence:CCGGGCTGATAGGAAGCTAAGTGAACTCGAGTTCACTTAGCTTCCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-2583s1c1
Sequence:CCGGCCAAGATAAGACTGTTGGATTCTCGAGAATCCAACAGTCTTATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014969.3-1668s1c1
Sequence:CCGGGCAGAATCTTACTGAACAGTTCTCGAGAACTGTTCAGTAAGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014969.3-3450s1c1
Sequence:CCGGCCAGGTGTTCAGAATTACTTTCTCGAGAAAGTAATTCTGAACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181400
VALIDATED
WDR47 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 47
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216176    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181400.3-3807s1c1
Sequence:CCGGCAATAGTCAATGGTAGGTTAACTCGAGTTAACCTACCATTGACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-894s1c1
Sequence:CCGGGCAAGTAACAATCGCTTATTCCTCGAGGAATAAGCGATTGTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-1908s1c1
Sequence:CCGGGATTCCAGTCAGAGGTTAATACTCGAGTATTAACCTCTGACTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-2454s1c1
Sequence:CCGGGATGGGACAATTCGAGATTTGCTCGAGCAAATCTCGAATTGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181400.2-637s1c1
Sequence:CCGGCGCTGAGTTTAAGGACTGGAACTCGAGTTCCAGTCCTTAAACTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-2385s1c1
Sequence:CCGGGAGCAGGAGATTGTAACATTTCTCGAGAAATGTTACAATCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-781s1c1
Sequence:CCGGCGTAATGAAGGGCCTACTTTACTCGAGTAAAGTAGGCCCTTCATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-573s1c1
Sequence:CCGGGCCCTTCTAAAGACGATTACACTCGAGTGTAATCGTCTTTAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181400.2-3381s1c1
Sequence:CCGGCCATACTGTATCACGTGTCTTCTCGAGAAGACACGTGATACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181400
VALIDATED
WDR47 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 47
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216176    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181400.3-3807s1c1
Sequence:CCGGCAATAGTCAATGGTAGGTTAACTCGAGTTAACCTACCATTGACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-894s1c1
Sequence:CCGGGCAAGTAACAATCGCTTATTCCTCGAGGAATAAGCGATTGTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-1908s1c1
Sequence:CCGGGATTCCAGTCAGAGGTTAATACTCGAGTATTAACCTCTGACTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-2454s1c1
Sequence:CCGGGATGGGACAATTCGAGATTTGCTCGAGCAAATCTCGAATTGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181400.2-637s1c1
Sequence:CCGGCGCTGAGTTTAAGGACTGGAACTCGAGTTCCAGTCCTTAAACTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-2385s1c1
Sequence:CCGGGAGCAGGAGATTGTAACATTTCTCGAGAAATGTTACAATCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-781s1c1
Sequence:CCGGCGTAATGAAGGGCCTACTTTACTCGAGTAAAGTAGGCCCTTCATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-573s1c1
Sequence:CCGGGCCCTTCTAAAGACGATTACACTCGAGTGTAATCGTCTTTAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181400.2-3381s1c1
Sequence:CCGGCCATACTGTATCACGTGTCTTCTCGAGAAGACACGTGATACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181400
VALIDATED
WDR47 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 47
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216176    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181400.3-3807s1c1
Sequence:CCGGCAATAGTCAATGGTAGGTTAACTCGAGTTAACCTACCATTGACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-894s1c1
Sequence:CCGGGCAAGTAACAATCGCTTATTCCTCGAGGAATAAGCGATTGTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-1908s1c1
Sequence:CCGGGATTCCAGTCAGAGGTTAATACTCGAGTATTAACCTCTGACTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181400.3-2454s1c1
Sequence:CCGGGATGGGACAATTCGAGATTTGCTCGAGCAAATCTCGAATTGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181400.2-637s1c1
Sequence:CCGGCGCTGAGTTTAAGGACTGGAACTCGAGTTCCAGTCCTTAAACTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-2385s1c1
Sequence:CCGGGAGCAGGAGATTGTAACATTTCTCGAGAAATGTTACAATCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-781s1c1
Sequence:CCGGCGTAATGAAGGGCCTACTTTACTCGAGTAAAGTAGGCCCTTCATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181400.2-573s1c1
Sequence:CCGGGCCCTTCTAAAGACGATTACACTCGAGTGTAATCGTCTTTAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181400.2-3381s1c1
Sequence:CCGGCCATACTGTATCACGTGTCTTCTCGAGAAGACACGTGATACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks