EMAIL THIS PAGE TO A FRIEND

WDR48

WD repeat domain 48

Synonyms: P80 UAF1
Gene ID:
Mouse(67561) WD repeat domain 48
Rat(363164) WD repeat domain 48
Zebrafish(334682) WD repeat domain 48
Horse(100068457) WD repeat domain 48
domestic cat(101100409) WD repeat domain 48
chicken(420427) WD repeat domain 48
dog(477027) WD repeat domain 48
cow(618860) WD repeat domain 48
sheep(101117282) WD repeat domain 48
domestic guinea pig(100734781) WD repeat domain 48
naked mole-rat(101709412) WD repeat domain 48
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020839 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020839 Rosetta Predictions human pricing
XM_001077618 Rosetta Predictions rat pricing
XM_343503 Rosetta Predictions rat pricing
NM_026236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023071 predicted 460
2 SASI_Hs01_00023072 predicted 1256
3 SASI_Hs01_00023074 predicted 2047
4 SASI_Hs01_00023076 predicted 231
5 SASI_Hs01_00023077 predicted 619
6 SASI_Hs01_00023078 predicted 1651
7 SASI_Hs01_00023079 predicted 1170
8 SASI_Hs01_00023080 predicted 840
9 SASI_Hs02_00354076 predicted 247
10 SASI_Hs02_00354077 predicted 1017
11 SASI_Hs01_00023073 predicted 581
12 SASI_Hs01_00023075 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357789 predicted 1740
2 SASI_Rn02_00357790 predicted 523
3 SASI_Rn02_00357791 predicted 344
4 SASI_Rn02_00357792 predicted 1481
5 SASI_Rn02_00357793 predicted 1205
6 SASI_Rn02_00357794 predicted 445
7 SASI_Rn02_00357795 predicted 410
8 SASI_Rn02_00357796 predicted 785
9 SASI_Rn02_00357797 predicted 599
10 SASI_Rn02_00357798 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395914 predicted 1739
2 SASI_Rn02_00395915 predicted 517
3 SASI_Rn02_00395916 predicted 345
4 SASI_Rn02_00395917 predicted 1485
5 SASI_Rn02_00395918 predicted 1207
6 SASI_Rn02_00395919 predicted 449
7 SASI_Rn02_00395920 predicted 1055
8 SASI_Rn02_00395921 predicted 418
9 SASI_Rn02_00395922 predicted 792
10 SASI_Rn02_00395923 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198528 predicted 428
2 SASI_Mm02_00329919 predicted 1517
3 SASI_Mm01_00198529 predicted 1159
4 SASI_Mm01_00198530 predicted 794
5 SASI_Mm01_00198531 predicted 322
6 SASI_Mm01_00198532 predicted 222
7 SASI_Mm01_00198533 predicted 850
8 SASI_Mm01_00198534 predicted 503
9 SASI_Mm01_00198535 predicted 1213
10 SASI_Mm01_00198536 predicted 957
11 SASI_Mm01_00198537 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026236
VALIDATED
WDR48 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 48
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026236.1-3002s1c1
Sequence:CCGGGCCGTCTTTCTAACAGTCAAACTCGAGTTTGACTGTTAGAAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026236.1-1977s1c1
Sequence:CCGGCGGACAGTAAAGCACTTCATACTCGAGTATGAAGTGCTTTACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026236.1-1134s1c1
Sequence:CCGGCGACACATATTAACCAAAGATCTCGAGATCTTTGGTTAATATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026236.1-233s1c1
Sequence:CCGGGCACCATACAGACTGGGTAAACTCGAGTTTACCCAGTCTGTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1975s21c1
Sequence:CCGGCGGACAGTAAAGCACTTCATACTCGAGTATGAAGTGCTTTACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1141s21c1
Sequence:CCGGTTAACCAAAGATACGAATAACCTCGAGGTTATTCGTATCTTTGGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-232s21c1
Sequence:CCGGCACCATACAGACTGGGTAAATCTCGAGATTTACCCAGTCTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-2139s21c1
Sequence:CCGGAGACCTCCAACCGGCCTATTTCTCGAGAAATAGGCCGGTTGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1010s21c1
Sequence:CCGGTTCGAGCCTCTGGTGATTATGCTCGAGCATAATCACCAGAGGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026236
VALIDATED
WDR48 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 48
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026236.1-3002s1c1
Sequence:CCGGGCCGTCTTTCTAACAGTCAAACTCGAGTTTGACTGTTAGAAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026236.1-1977s1c1
Sequence:CCGGCGGACAGTAAAGCACTTCATACTCGAGTATGAAGTGCTTTACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026236.1-1134s1c1
Sequence:CCGGCGACACATATTAACCAAAGATCTCGAGATCTTTGGTTAATATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026236.1-233s1c1
Sequence:CCGGGCACCATACAGACTGGGTAAACTCGAGTTTACCCAGTCTGTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1975s21c1
Sequence:CCGGCGGACAGTAAAGCACTTCATACTCGAGTATGAAGTGCTTTACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1141s21c1
Sequence:CCGGTTAACCAAAGATACGAATAACCTCGAGGTTATTCGTATCTTTGGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-232s21c1
Sequence:CCGGCACCATACAGACTGGGTAAATCTCGAGATTTACCCAGTCTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-2139s21c1
Sequence:CCGGAGACCTCCAACCGGCCTATTTCTCGAGAAATAGGCCGGTTGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1010s21c1
Sequence:CCGGTTCGAGCCTCTGGTGATTATGCTCGAGCATAATCACCAGAGGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026236
VALIDATED
WDR48 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 48
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026236.1-3002s1c1
Sequence:CCGGGCCGTCTTTCTAACAGTCAAACTCGAGTTTGACTGTTAGAAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026236.1-1977s1c1
Sequence:CCGGCGGACAGTAAAGCACTTCATACTCGAGTATGAAGTGCTTTACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026236.1-1134s1c1
Sequence:CCGGCGACACATATTAACCAAAGATCTCGAGATCTTTGGTTAATATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026236.1-233s1c1
Sequence:CCGGGCACCATACAGACTGGGTAAACTCGAGTTTACCCAGTCTGTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1975s21c1
Sequence:CCGGCGGACAGTAAAGCACTTCATACTCGAGTATGAAGTGCTTTACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1141s21c1
Sequence:CCGGTTAACCAAAGATACGAATAACCTCGAGGTTATTCGTATCTTTGGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-232s21c1
Sequence:CCGGCACCATACAGACTGGGTAAATCTCGAGATTTACCCAGTCTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-2139s21c1
Sequence:CCGGAGACCTCCAACCGGCCTATTTCTCGAGAAATAGGCCGGTTGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026236.3-1010s21c1
Sequence:CCGGTTCGAGCCTCTGGTGATTATGCTCGAGCATAATCACCAGAGGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020839
WDR48 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 48
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-1706s1c1
Sequence:CCGGCCTTTCTACCTCCAACCTCATCTCGAGATGAGGTTGGAGGTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-53s1c1
Sequence:CCGGGTGCAGGTTTCCTATGTTATTCTCGAGAATAACATAGGAAACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020839.2-2279s1c1
Sequence:CCGGGCAGACTATGTCTTTCAAGATCTCGAGATCTTGAAAGACATAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-733s1c1
Sequence:CCGGGCAGAGATGTATAGCAACATACTCGAGTATGTTGCTATACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-471s1c1
Sequence:CCGGCCTCAAATAACACTGTCACAACTCGAGTTGTGACAGTGTTATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020839
WDR48 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 48
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-1706s1c1
Sequence:CCGGCCTTTCTACCTCCAACCTCATCTCGAGATGAGGTTGGAGGTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-53s1c1
Sequence:CCGGGTGCAGGTTTCCTATGTTATTCTCGAGAATAACATAGGAAACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020839.2-2279s1c1
Sequence:CCGGGCAGACTATGTCTTTCAAGATCTCGAGATCTTGAAAGACATAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-733s1c1
Sequence:CCGGGCAGAGATGTATAGCAACATACTCGAGTATGTTGCTATACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-471s1c1
Sequence:CCGGCCTCAAATAACACTGTCACAACTCGAGTTGTGACAGTGTTATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020839
WDR48 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 48
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-1706s1c1
Sequence:CCGGCCTTTCTACCTCCAACCTCATCTCGAGATGAGGTTGGAGGTAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-53s1c1
Sequence:CCGGGTGCAGGTTTCCTATGTTATTCTCGAGAATAACATAGGAAACCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020839.2-2279s1c1
Sequence:CCGGGCAGACTATGTCTTTCAAGATCTCGAGATCTTGAAAGACATAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-733s1c1
Sequence:CCGGGCAGAGATGTATAGCAACATACTCGAGTATGTTGCTATACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020839.2-471s1c1
Sequence:CCGGCCTCAAATAACACTGTCACAACTCGAGTTGTGACAGTGTTATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks