EMAIL THIS PAGE TO A FRIEND

WDR49

WD repeat domain 49

UniProtKB ID: Q8IV35, Q8N297
Gene ID:
Mouse(213248) WD repeat domain 49
Rat(499640) WD repeat domain 49
naked mole-rat(101723032) WD repeat domain 49
cow(785089) WD repeat domain 49
sheep(101115178) WD repeat domain 49
domestic cat(101099829) WD repeat domain 49
dog(488144) WD repeat domain 49
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178824 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071431 MISSION® esiRNA esiRNA human WDR49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178824 Rosetta Predictions human pricing
XM_001068667 Rosetta Predictions rat pricing
XM_574961 Rosetta Predictions rat pricing
XM_143339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019422 predicted 1853
2 SASI_Hs01_00019423 predicted 1897
3 SASI_Hs01_00019424 predicted 1246
4 SASI_Hs02_00369869 predicted 1407
5 SASI_Hs01_00019426 predicted 800
6 SASI_Hs01_00019427 predicted 964
7 SASI_Hs01_00019428 predicted 2004
8 SASI_Hs01_00019429 predicted 493
9 SASI_Hs01_00019430 predicted 1954
10 SASI_Hs01_00019431 predicted 742
11 SASI_Hs01_00019425 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325389 predicted 727
2 SASI_Rn02_00325390 predicted 248
3 SASI_Rn02_00325391 predicted 680
4 SASI_Rn02_00325392 predicted 1972
5 SASI_Rn02_00325393 predicted 1467
6 SASI_Rn02_00325394 predicted 977
7 SASI_Rn02_00325395 predicted 1347
8 SASI_Rn02_00325396 predicted 1880
9 SASI_Rn02_00325397 predicted 486
10 SASI_Rn02_00325398 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402826 predicted 916
2 SASI_Rn02_00402827 predicted 440
3 SASI_Rn02_00402828 predicted 862
4 SASI_Rn02_00402829 predicted 2159
5 SASI_Rn02_00402830 predicted 1655
6 SASI_Rn02_00402831 predicted 1162
7 SASI_Rn02_00402832 predicted 1530
8 SASI_Rn02_00402833 predicted 2075
9 SASI_Rn02_00402834 predicted 665
10 SASI_Rn02_00402835 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205909 predicted 738
2 SASI_Mm01_00205910 predicted 1320
3 SASI_Mm01_00205911 predicted 2215
4 SASI_Mm01_00205913 predicted 976
5 SASI_Mm01_00205914 predicted 1946
6 SASI_Mm01_00205915 predicted 851
7 SASI_Mm02_00425179 predicted 2352
8 SASI_Mm02_00425180 predicted 538
9 SASI_Mm01_00205916 predicted 1595
10 SASI_Mm01_00205917 predicted 2124
11 SASI_Mm01_00205908 predicted 1498
12 SASI_Mm01_00205912 predicted 1711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178824
WDR49 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 49
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178824.3-385s21c1
Sequence:CCGGTATCACTCTCGGCTCAATTTACTCGAGTAAATTGAGCCGAGAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178824.3-2027s21c1
Sequence:CCGGTCAGACCATCAGAAGATATAACTCGAGTTATATCTTCTGATGGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-506s1c1
Sequence:CCGGCCGTCCAATTCTTTGTGGAAACTCGAGTTTCCACAAAGAATTGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-696s1c1
Sequence:CCGGGCTAGCATTGTTGGCAATGAACTCGAGTTCATTGCCAACAATGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-936s1c1
Sequence:CCGGCAGCACAGATGGGACTGTAAACTCGAGTTTACAGTCCCATCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-743s1c1
Sequence:CCGGGCCATGAGAAAGCAGTCACTTCTCGAGAAGTGACTGCTTTCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178824
WDR49 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 49
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178824.3-385s21c1
Sequence:CCGGTATCACTCTCGGCTCAATTTACTCGAGTAAATTGAGCCGAGAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178824.3-2027s21c1
Sequence:CCGGTCAGACCATCAGAAGATATAACTCGAGTTATATCTTCTGATGGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-506s1c1
Sequence:CCGGCCGTCCAATTCTTTGTGGAAACTCGAGTTTCCACAAAGAATTGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-696s1c1
Sequence:CCGGGCTAGCATTGTTGGCAATGAACTCGAGTTCATTGCCAACAATGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-936s1c1
Sequence:CCGGCAGCACAGATGGGACTGTAAACTCGAGTTTACAGTCCCATCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-743s1c1
Sequence:CCGGGCCATGAGAAAGCAGTCACTTCTCGAGAAGTGACTGCTTTCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178824
WDR49 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 49
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178824.3-385s21c1
Sequence:CCGGTATCACTCTCGGCTCAATTTACTCGAGTAAATTGAGCCGAGAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178824.3-2027s21c1
Sequence:CCGGTCAGACCATCAGAAGATATAACTCGAGTTATATCTTCTGATGGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-506s1c1
Sequence:CCGGCCGTCCAATTCTTTGTGGAAACTCGAGTTTCCACAAAGAATTGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-696s1c1
Sequence:CCGGGCTAGCATTGTTGGCAATGAACTCGAGTTCATTGCCAACAATGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-936s1c1
Sequence:CCGGCAGCACAGATGGGACTGTAAACTCGAGTTTACAGTCCCATCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178824.3-743s1c1
Sequence:CCGGGCCATGAGAAAGCAGTCACTTCTCGAGAAGTGACTGCTTTCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks