EMAIL THIS PAGE TO A FRIEND

WDR4

WD repeat domain 4

Synonyms: TRM82 TRMT82
Gene ID:
Human(10785) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Mouse(57773) WD repeat domain 4
Rat(690032) WD repeat domain 4
Zebrafish(570351) WD repeat domain 4
dog(487783) WD repeat domain 4
Horse(100057729) WD repeat domain 4
domestic cat(101093290) WD repeat domain 4
chicken(418540) WD repeat domain 4
cow(508051) WD repeat domain 4
sheep(101121998) WD repeat domain 4
domestic guinea pig(100734322) WD repeat domain 4
naked mole-rat(101706819) WD repeat domain 4
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018669 Rosetta Predictions human pricing
NM_033661 Rosetta Predictions human pricing
NM_021322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238605 predicted 306
2 SASI_Hs01_00238606 predicted 1049
3 SASI_Hs01_00238607 predicted 277
4 SASI_Hs01_00238608 predicted 374
5 SASI_Hs01_00238609 predicted 635
6 SASI_Hs01_00238611 predicted 259
7 SASI_Hs01_00238613 predicted 353
8 SASI_Hs02_00352183 predicted 899
9 SASI_Hs01_00238614 predicted 647
10 SASI_Hs02_00352184 predicted 1041
11 SASI_Hs01_00238610 predicted 1080
12 SASI_Hs01_00238612 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153135 predicted 308
2 SASI_Hs01_00153136 predicted 1052
3 SASI_Hs01_00153137 predicted 273
4 SASI_Hs01_00153138 predicted 376
5 SASI_Hs01_00153139 predicted 635
6 SASI_Hs01_00153141 predicted 254
7 SASI_Hs01_00153143 predicted 356
8 SASI_Hs02_00361471 predicted 890
9 SASI_Hs01_00153144 predicted 641
10 SASI_Hs02_00361472 predicted 1042
11 SASI_Hs01_00153140 predicted 1070
12 SASI_Hs01_00153142 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325877 predicted 1105
2 SASI_Mm01_00182711 predicted 567
3 SASI_Mm01_00182712 predicted 878
4 SASI_Mm01_00182713 predicted 1463
5 SASI_Mm01_00182714 predicted 492
6 SASI_Mm01_00182715 predicted 1644
7 SASI_Mm01_00182716 predicted 1382
8 SASI_Mm01_00182717 predicted 776
9 SASI_Mm01_00182718 predicted 572
10 SASI_Mm01_00182719 predicted 213
11 SASI_Mm01_00182710 predicted 1466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021322
VALIDATED
WDR4 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-1106s1c1
Sequence:CCGGCAACATGACCTCTTACCTGAACTCGAGTTCAGGTAAGAGGTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-246s1c1
Sequence:CCGGGATGACAGTAAGCGTCTGATTCTCGAGAATCAGACGCTTACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-604s1c1
Sequence:CCGGGTCATCCTGAACTGCTGCTTTCTCGAGAAAGCAGCAGTTCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021322.1-2091s1c1
Sequence:CCGGGCATAACTGTAACCCTAATACCTCGAGGTATTAGGGTTACAGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-2090s21c1
Sequence:CCGGAGCATAACTGTAACCCTAATACTCGAGTATTAGGGTTACAGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-247s21c1
Sequence:CCGGATGACAGTAAGCGTCTGATTCCTCGAGGAATCAGACGCTTACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-537s21c1
Sequence:CCGGCCGCATAGCATCGAGTCTTTCCTCGAGGAAAGACTCGATGCTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-215s21c1
Sequence:CCGGCTCCAAGTCTGGCCGCTATTTCTCGAGAAATAGCGGCCAGACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-1101s21c1
Sequence:CCGGTTTGACAACATGACCTCTTACCTCGAGGTAAGAGGTCATGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021322
VALIDATED
WDR4 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-1106s1c1
Sequence:CCGGCAACATGACCTCTTACCTGAACTCGAGTTCAGGTAAGAGGTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-246s1c1
Sequence:CCGGGATGACAGTAAGCGTCTGATTCTCGAGAATCAGACGCTTACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-604s1c1
Sequence:CCGGGTCATCCTGAACTGCTGCTTTCTCGAGAAAGCAGCAGTTCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021322.1-2091s1c1
Sequence:CCGGGCATAACTGTAACCCTAATACCTCGAGGTATTAGGGTTACAGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-2090s21c1
Sequence:CCGGAGCATAACTGTAACCCTAATACTCGAGTATTAGGGTTACAGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-247s21c1
Sequence:CCGGATGACAGTAAGCGTCTGATTCCTCGAGGAATCAGACGCTTACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-537s21c1
Sequence:CCGGCCGCATAGCATCGAGTCTTTCCTCGAGGAAAGACTCGATGCTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-215s21c1
Sequence:CCGGCTCCAAGTCTGGCCGCTATTTCTCGAGAAATAGCGGCCAGACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-1101s21c1
Sequence:CCGGTTTGACAACATGACCTCTTACCTCGAGGTAAGAGGTCATGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021322
VALIDATED
WDR4 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-1106s1c1
Sequence:CCGGCAACATGACCTCTTACCTGAACTCGAGTTCAGGTAAGAGGTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-246s1c1
Sequence:CCGGGATGACAGTAAGCGTCTGATTCTCGAGAATCAGACGCTTACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021322.1-604s1c1
Sequence:CCGGGTCATCCTGAACTGCTGCTTTCTCGAGAAAGCAGCAGTTCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217432    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021322.1-2091s1c1
Sequence:CCGGGCATAACTGTAACCCTAATACCTCGAGGTATTAGGGTTACAGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-2090s21c1
Sequence:CCGGAGCATAACTGTAACCCTAATACTCGAGTATTAGGGTTACAGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-247s21c1
Sequence:CCGGATGACAGTAAGCGTCTGATTCCTCGAGGAATCAGACGCTTACTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-537s21c1
Sequence:CCGGCCGCATAGCATCGAGTCTTTCCTCGAGGAAAGACTCGATGCTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-215s21c1
Sequence:CCGGCTCCAAGTCTGGCCGCTATTTCTCGAGAAATAGCGGCCAGACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021322.1-1101s21c1
Sequence:CCGGTTTGACAACATGACCTCTTACCTCGAGGTAAGAGGTCATGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018669
VALIDATED
WDR4 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-160s1c1
Sequence:CCGGCAGTGATGATGACAGCCTCTTCTCGAGAAGAGGCTGTCATCATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-310s1c1
Sequence:CCGGCGATGACAGTAAGCGTCTGATCTCGAGATCAGACGCTTACTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018669.4-1770s1c1
Sequence:CCGGGCTGTTGAAACTCAGCACGAACTCGAGTTCGTGCTGAGTTTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-502s1c1
Sequence:CCGGGCACCTGTCTATGCTGTTAGACTCGAGTCTAACAGCATAGACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018669.4-1062s1c1
Sequence:CCGGGCACCGTGTTAAAGAAAGTCTCTCGAGAGACTTTCTTTAACACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1293s21c1
Sequence:CCGGAGGCGACGCTAAGTTGCTGATCTCGAGATCAGCAACTTAGCGTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1171s21c1
Sequence:CCGGCAACGTGACCTCCTACCTGAACTCGAGTTCAGGTAGGAGGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018669.4-1667s21c1
Sequence:CCGGCATCTGTGGGCTGACGTTTCTCTCGAGAGAAACGTCAGCCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-570s21c1
Sequence:CCGGACGAGAAGATCCGAGTCAGCTCTCGAGAGCTGACTCGGATCTTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-637s21c1
Sequence:CCGGAGAGTTTGTGAGCCGTATCTCCTCGAGGAGATACGGCTCACAAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1266s21c1
Sequence:CCGGGGCATGCCAAGAAGATGAGACCTCGAGGTCTCATCTTCTTGGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1084s21c1
Sequence:CCGGTGGTGTTCTTCGTGGGAACTGCTCGAGCAGTTCCCACGAAGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1148s21c1
Sequence:CCGGAGTCTCTACAAGGCCACGTTCCTCGAGGAACGTGGCCTTGTAGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018669
VALIDATED
WDR4 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-160s1c1
Sequence:CCGGCAGTGATGATGACAGCCTCTTCTCGAGAAGAGGCTGTCATCATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-310s1c1
Sequence:CCGGCGATGACAGTAAGCGTCTGATCTCGAGATCAGACGCTTACTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018669.4-1770s1c1
Sequence:CCGGGCTGTTGAAACTCAGCACGAACTCGAGTTCGTGCTGAGTTTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-502s1c1
Sequence:CCGGGCACCTGTCTATGCTGTTAGACTCGAGTCTAACAGCATAGACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018669.4-1062s1c1
Sequence:CCGGGCACCGTGTTAAAGAAAGTCTCTCGAGAGACTTTCTTTAACACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1293s21c1
Sequence:CCGGAGGCGACGCTAAGTTGCTGATCTCGAGATCAGCAACTTAGCGTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1171s21c1
Sequence:CCGGCAACGTGACCTCCTACCTGAACTCGAGTTCAGGTAGGAGGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018669.4-1667s21c1
Sequence:CCGGCATCTGTGGGCTGACGTTTCTCTCGAGAGAAACGTCAGCCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-570s21c1
Sequence:CCGGACGAGAAGATCCGAGTCAGCTCTCGAGAGCTGACTCGGATCTTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-637s21c1
Sequence:CCGGAGAGTTTGTGAGCCGTATCTCCTCGAGGAGATACGGCTCACAAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1266s21c1
Sequence:CCGGGGCATGCCAAGAAGATGAGACCTCGAGGTCTCATCTTCTTGGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1084s21c1
Sequence:CCGGTGGTGTTCTTCGTGGGAACTGCTCGAGCAGTTCCCACGAAGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1148s21c1
Sequence:CCGGAGTCTCTACAAGGCCACGTTCCTCGAGGAACGTGGCCTTGTAGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018669
VALIDATED
WDR4 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-160s1c1
Sequence:CCGGCAGTGATGATGACAGCCTCTTCTCGAGAAGAGGCTGTCATCATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-310s1c1
Sequence:CCGGCGATGACAGTAAGCGTCTGATCTCGAGATCAGACGCTTACTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018669.4-1770s1c1
Sequence:CCGGGCTGTTGAAACTCAGCACGAACTCGAGTTCGTGCTGAGTTTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018669.4-502s1c1
Sequence:CCGGGCACCTGTCTATGCTGTTAGACTCGAGTCTAACAGCATAGACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018669.4-1062s1c1
Sequence:CCGGGCACCGTGTTAAAGAAAGTCTCTCGAGAGACTTTCTTTAACACGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1293s21c1
Sequence:CCGGAGGCGACGCTAAGTTGCTGATCTCGAGATCAGCAACTTAGCGTCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1171s21c1
Sequence:CCGGCAACGTGACCTCCTACCTGAACTCGAGTTCAGGTAGGAGGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018669.4-1667s21c1
Sequence:CCGGCATCTGTGGGCTGACGTTTCTCTCGAGAGAAACGTCAGCCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-570s21c1
Sequence:CCGGACGAGAAGATCCGAGTCAGCTCTCGAGAGCTGACTCGGATCTTCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-637s21c1
Sequence:CCGGAGAGTTTGTGAGCCGTATCTCCTCGAGGAGATACGGCTCACAAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1266s21c1
Sequence:CCGGGGCATGCCAAGAAGATGAGACCTCGAGGTCTCATCTTCTTGGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1084s21c1
Sequence:CCGGTGGTGTTCTTCGTGGGAACTGCTCGAGCAGTTCCCACGAAGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018669.4-1148s21c1
Sequence:CCGGAGTCTCTACAAGGCCACGTTCCTCGAGGAACGTGGCCTTGTAGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks