EMAIL THIS PAGE TO A FRIEND

WDR52

WD repeat domain 52

UniProtKB ID: Q96MT7
Gene ID:
Mouse(212517) WD repeat domain 52
Rat(363782) WD repeat domain 52
chicken(418359) WD repeat domain 52
domestic cat(101090131) WD repeat domain 52
Horse(100071418) WD repeat domain 52
dog(478567) WD repeat domain 52
naked mole-rat(101698277) WD repeat domain 52
domestic guinea pig(100713007) WD repeat domain 52
cow(513653) WD repeat domain 52
sheep(101115253) WD repeat domain 52
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018338 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU174461 MISSION® esiRNA esiRNA targeting mouse Wdr52 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018338 Rosetta Predictions human pricing
NM_001134590 Rosetta Predictions rat pricing
XM_489567 Rosetta Predictions mouse pricing
XM_991190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235787 predicted 742
2 SASI_Hs01_00235788 predicted 1008
3 SASI_Hs01_00235789 predicted 1626
4 SASI_Hs01_00235790 predicted 1131
5 SASI_Hs01_00235791 predicted 2834
6 SASI_Hs01_00235792 predicted 1128
7 SASI_Hs01_00235793 predicted 736
8 SASI_Hs01_00235794 predicted 818
9 SASI_Hs01_00235795 predicted 1203
10 SASI_Hs01_00235796 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257379 predicted 3219
2 SASI_Rn02_00257380 predicted 997
3 SASI_Rn02_00257381 predicted 2415
4 SASI_Rn02_00257382 predicted 1784
5 SASI_Rn02_00257383 predicted 1202
6 SASI_Rn02_00257384 predicted 2893
7 SASI_Rn02_00257385 predicted 2186
8 SASI_Rn02_00257386 predicted 1569
9 SASI_Rn02_00257387 predicted 1171
10 SASI_Rn02_00257388 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_489567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427233 predicted 1615
2 SASI_Mm02_00427234 predicted 2337
3 SASI_Mm02_00427235 predicted 4590
4 SASI_Mm02_00427236 predicted 1544
5 SASI_Mm02_00427237 predicted 3072
6 SASI_Mm02_00427238 predicted 5412
7 SASI_Mm02_00427239 predicted 1346
8 SASI_Mm02_00427240 predicted 4640
9 SASI_Mm02_00427241 predicted 709
10 SASI_Mm02_00427242 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252937 predicted 1610
2 SASI_Mm02_00450628 predicted 1009
3 SASI_Mm02_00450629 predicted 4591
4 SASI_Mm01_00252939 predicted 1541
5 SASI_Mm02_00450630 predicted 1180
6 SASI_Mm02_00450631 predicted 3080
7 SASI_Mm01_00252941 predicted 1776
8 SASI_Mm01_00252942 predicted 1346
9 SASI_Mm02_00450632 predicted 4648
10 SASI_Mm02_00450633 predicted 710
11 SASI_Mm01_00252933 predicted 2215
12 SASI_Mm01_00252934 predicted 1515
13 SASI_Mm01_00252935 predicted 1761
14 SASI_Mm01_00252936 predicted 2356
15 SASI_Mm01_00252938 predicted 2286
16 SASI_Mm01_00252940 predicted 2332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018338
WDR52 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 52
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-1833s21c1
Sequence:CCGGTTCTAGCCACAGGGAGTAAAGCTCGAGCTTTACTCCCTGTGGCTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-615s21c1
Sequence:CCGGGTGAAGGAATTGGCGTCATTGCTCGAGCAATGACGCCAATTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-999s21c1
Sequence:CCGGAGGGATCACTAGGTCGATTTGCTCGAGCAAATCGACCTAGTGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-927s1c1
Sequence:CCGGGCCACATCAAGTTCTGGGAAACTCGAGTTTCCCAGAACTTGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2429s1c1
Sequence:CCGGCCTATTGATGTCCGTTATCTTCTCGAGAAGATAACGGACATCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018338.2-3047s1c1
Sequence:CCGGCCCAACAAGTAGAAACACTTACTCGAGTAAGTGTTTCTACTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2537s1c1
Sequence:CCGGCGAGTCTATGTCCTAAATCAACTCGAGTTGATTTAGGACATAGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2473s1c1
Sequence:CCGGCCAAACTATCACTTTCAACATCTCGAGATGTTGAAAGTGATAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-1730s1c1
Sequence:CCGGGATGCTGATATTCAGTTGAAACTCGAGTTTCAACTGAATATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2954s1c1
Sequence:CCGGCCAAAGCATATGCAGTTTAAACTCGAGTTTAAACTGCATATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2640s1c1
Sequence:CCGGCTAATAGCTTTGATGATCGTTCTCGAGAACGATCATCAAAGCTATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018338
WDR52 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 52
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-1833s21c1
Sequence:CCGGTTCTAGCCACAGGGAGTAAAGCTCGAGCTTTACTCCCTGTGGCTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-615s21c1
Sequence:CCGGGTGAAGGAATTGGCGTCATTGCTCGAGCAATGACGCCAATTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-999s21c1
Sequence:CCGGAGGGATCACTAGGTCGATTTGCTCGAGCAAATCGACCTAGTGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-927s1c1
Sequence:CCGGGCCACATCAAGTTCTGGGAAACTCGAGTTTCCCAGAACTTGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2429s1c1
Sequence:CCGGCCTATTGATGTCCGTTATCTTCTCGAGAAGATAACGGACATCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018338.2-3047s1c1
Sequence:CCGGCCCAACAAGTAGAAACACTTACTCGAGTAAGTGTTTCTACTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2537s1c1
Sequence:CCGGCGAGTCTATGTCCTAAATCAACTCGAGTTGATTTAGGACATAGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2473s1c1
Sequence:CCGGCCAAACTATCACTTTCAACATCTCGAGATGTTGAAAGTGATAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-1730s1c1
Sequence:CCGGGATGCTGATATTCAGTTGAAACTCGAGTTTCAACTGAATATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2954s1c1
Sequence:CCGGCCAAAGCATATGCAGTTTAAACTCGAGTTTAAACTGCATATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2640s1c1
Sequence:CCGGCTAATAGCTTTGATGATCGTTCTCGAGAACGATCATCAAAGCTATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018338
WDR52 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 52
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-1833s21c1
Sequence:CCGGTTCTAGCCACAGGGAGTAAAGCTCGAGCTTTACTCCCTGTGGCTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-615s21c1
Sequence:CCGGGTGAAGGAATTGGCGTCATTGCTCGAGCAATGACGCCAATTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018338.3-999s21c1
Sequence:CCGGAGGGATCACTAGGTCGATTTGCTCGAGCAAATCGACCTAGTGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-927s1c1
Sequence:CCGGGCCACATCAAGTTCTGGGAAACTCGAGTTTCCCAGAACTTGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2429s1c1
Sequence:CCGGCCTATTGATGTCCGTTATCTTCTCGAGAAGATAACGGACATCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018338.2-3047s1c1
Sequence:CCGGCCCAACAAGTAGAAACACTTACTCGAGTAAGTGTTTCTACTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2537s1c1
Sequence:CCGGCGAGTCTATGTCCTAAATCAACTCGAGTTGATTTAGGACATAGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2473s1c1
Sequence:CCGGCCAAACTATCACTTTCAACATCTCGAGATGTTGAAAGTGATAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-1730s1c1
Sequence:CCGGGATGCTGATATTCAGTTGAAACTCGAGTTTCAACTGAATATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2954s1c1
Sequence:CCGGCCAAAGCATATGCAGTTTAAACTCGAGTTTAAACTGCATATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018338.2-2640s1c1
Sequence:CCGGCTAATAGCTTTGATGATCGTTCTCGAGAACGATCATCAAAGCTATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033247
WDR52 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 52
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1209s21c1
Sequence:CCGGTCGACACTGCTGACGTTATAGCTCGAGCTATAACGTCAGCAGTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1110s21c1
Sequence:CCGGCTTGTCACAGCGGTTCCATTACTCGAGTAATGGAACCGCTGTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-865s21c1
Sequence:CCGGTGATAATGATGAGCAATTAACCTCGAGGTTAATTGCTCATCATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033247.1-5655s21c1
Sequence:CCGGCAACAATCCTCTCGCTTTAAACTCGAGTTTAAAGCGAGAGGATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-2806s21c1
Sequence:CCGGACGAGAGCATGACAAGTTAATCTCGAGATTAACTTGTCATGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1958s21c1
Sequence:CCGGAGTCTATGCCCAACCATTAAGCTCGAGCTTAATGGTTGGGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-2435s21c1
Sequence:CCGGCCCATCAGAAATATCACTTTCCTCGAGGAAAGTGATATTTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033247
WDR52 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 52
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1209s21c1
Sequence:CCGGTCGACACTGCTGACGTTATAGCTCGAGCTATAACGTCAGCAGTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1110s21c1
Sequence:CCGGCTTGTCACAGCGGTTCCATTACTCGAGTAATGGAACCGCTGTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-865s21c1
Sequence:CCGGTGATAATGATGAGCAATTAACCTCGAGGTTAATTGCTCATCATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033247.1-5655s21c1
Sequence:CCGGCAACAATCCTCTCGCTTTAAACTCGAGTTTAAAGCGAGAGGATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-2806s21c1
Sequence:CCGGACGAGAGCATGACAAGTTAATCTCGAGATTAACTTGTCATGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1958s21c1
Sequence:CCGGAGTCTATGCCCAACCATTAAGCTCGAGCTTAATGGTTGGGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-2435s21c1
Sequence:CCGGCCCATCAGAAATATCACTTTCCTCGAGGAAAGTGATATTTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033247
WDR52 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 52
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1209s21c1
Sequence:CCGGTCGACACTGCTGACGTTATAGCTCGAGCTATAACGTCAGCAGTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1110s21c1
Sequence:CCGGCTTGTCACAGCGGTTCCATTACTCGAGTAATGGAACCGCTGTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-865s21c1
Sequence:CCGGTGATAATGATGAGCAATTAACCTCGAGGTTAATTGCTCATCATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033247.1-5655s21c1
Sequence:CCGGCAACAATCCTCTCGCTTTAAACTCGAGTTTAAAGCGAGAGGATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-2806s21c1
Sequence:CCGGACGAGAGCATGACAAGTTAATCTCGAGATTAACTTGTCATGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-1958s21c1
Sequence:CCGGAGTCTATGCCCAACCATTAAGCTCGAGCTTAATGGTTGGGCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033247.1-2435s21c1
Sequence:CCGGCCCATCAGAAATATCACTTTCCTCGAGGAAAGTGATATTTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks