EMAIL THIS PAGE TO A FRIEND

WDR53

WD repeat domain 53

UniProtKB ID: Q7Z5U6
Gene ID:
Human(348793) Summary: This gene encodes a protein containing WD domains. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
Mouse(68980) WD repeat domain 53
Rat(498097) WD repeat domain 53
chicken(770128) WD repeat domain 53
dog(488030) WD repeat domain 53
domestic cat(101087168) WD repeat domain 53
Horse(100060255) WD repeat domain 53
cow(518441) WD repeat domain 53
sheep(101122487) WD repeat domain 53
domestic guinea pig(100714517) WD repeat domain 53
naked mole-rat(101708802) WD repeat domain 53
Domestic Rabbit(100341026) WD repeat domain 53
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046901 MISSION® esiRNA esiRNA human WDR53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182627 Rosetta Predictions human pricing
NM_001109055 Rosetta Predictions rat pricing
NM_026898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167116 predicted 926
2 SASI_Hs01_00167117 predicted 756
3 SASI_Hs01_00167118 predicted 847
4 SASI_Hs01_00167119 predicted 684
5 SASI_Hs01_00167120 predicted 1272
6 SASI_Hs01_00167121 predicted 614
7 SASI_Hs02_00370780 predicted 626
8 SASI_Hs01_00167122 predicted 1148
9 SASI_Hs01_00167123 predicted 985
10 SASI_Hs01_00167124 predicted 579
11 SASI_Hs01_00167115 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244680 predicted 1031
2 SASI_Rn02_00244681 predicted 379
3 SASI_Rn02_00244682 predicted 858
4 SASI_Rn02_00244683 predicted 571
5 SASI_Rn02_00244684 predicted 965
6 SASI_Rn02_00244685 predicted 962
7 SASI_Rn02_00244686 predicted 577
8 SASI_Rn02_00244687 predicted 624
9 SASI_Rn02_00244688 predicted 949
10 SASI_Rn02_00244689 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055272 predicted 953
2 SASI_Mm01_00055273 predicted 475
3 SASI_Mm02_00331170 predicted 484
4 SASI_Mm01_00055274 predicted 449
5 SASI_Mm01_00055275 predicted 705
6 SASI_Mm01_00055276 predicted 760
7 SASI_Mm01_00055277 predicted 1066
8 SASI_Mm01_00055278 predicted 285
9 SASI_Mm01_00055279 predicted 572
10 SASI_Mm01_00055280 predicted 919
11 SASI_Mm01_00055281 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182627
WDR53 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 53
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182627.1-849s1c1
Sequence:CCGGGAAAGTTATCAGATCCTTGAACTCGAGTTCAAGGATCTGATAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182627.1-769s1c1
Sequence:CCGGCTTTCATTGAATCAAACGGAACTCGAGTTCCGTTTGATTCAATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-979s21c1
Sequence:CCGGCGACCACTCTGGATTACAAATCTCGAGATTTGTAATCCAGAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1215s21c1
Sequence:CCGGCTTTCTCCCAGAATCCTATTTCTCGAGAAATAGGATTCTGGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-511s21c1
Sequence:CCGGCTCTGCCTGAATGCAAGTAAACTCGAGTTTACTTGCATTCAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1140s21c1
Sequence:CCGGCTTTCGGGTGATGGGAGTTAACTCGAGTTAACTCCCATCACCCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1083s21c1
Sequence:CCGGTGTGGCTTCGTGTGGTAATATCTCGAGATATTACCACACGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182627
WDR53 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 53
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182627.1-849s1c1
Sequence:CCGGGAAAGTTATCAGATCCTTGAACTCGAGTTCAAGGATCTGATAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182627.1-769s1c1
Sequence:CCGGCTTTCATTGAATCAAACGGAACTCGAGTTCCGTTTGATTCAATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-979s21c1
Sequence:CCGGCGACCACTCTGGATTACAAATCTCGAGATTTGTAATCCAGAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1215s21c1
Sequence:CCGGCTTTCTCCCAGAATCCTATTTCTCGAGAAATAGGATTCTGGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-511s21c1
Sequence:CCGGCTCTGCCTGAATGCAAGTAAACTCGAGTTTACTTGCATTCAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1140s21c1
Sequence:CCGGCTTTCGGGTGATGGGAGTTAACTCGAGTTAACTCCCATCACCCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1083s21c1
Sequence:CCGGTGTGGCTTCGTGTGGTAATATCTCGAGATATTACCACACGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182627
WDR53 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 53
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182627.1-849s1c1
Sequence:CCGGGAAAGTTATCAGATCCTTGAACTCGAGTTCAAGGATCTGATAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182627.1-769s1c1
Sequence:CCGGCTTTCATTGAATCAAACGGAACTCGAGTTCCGTTTGATTCAATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-979s21c1
Sequence:CCGGCGACCACTCTGGATTACAAATCTCGAGATTTGTAATCCAGAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1215s21c1
Sequence:CCGGCTTTCTCCCAGAATCCTATTTCTCGAGAAATAGGATTCTGGGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-511s21c1
Sequence:CCGGCTCTGCCTGAATGCAAGTAAACTCGAGTTTACTTGCATTCAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1140s21c1
Sequence:CCGGCTTTCGGGTGATGGGAGTTAACTCGAGTTAACTCCCATCACCCGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182627.1-1083s21c1
Sequence:CCGGTGTGGCTTCGTGTGGTAATATCTCGAGATATTACCACACGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026898
WDR53 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 53
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026898.1-1198s1c1
Sequence:CCGGGATTCTGCCAAAGCTCGATATCTCGAGATATCGAGCTTTGGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-927s21c1
Sequence:CCGGTCAGGGTGATGGGAGTCAAATCTCGAGATTTGACTCCCATCACCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-869s21c1
Sequence:CCGGGTAGCGTCGTGCGGCAATATTCTCGAGAATATTGCCGCACGACGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-1198s21c1
Sequence:CCGGGATTCTGCCAAAGCTCGATATCTCGAGATATCGAGCTTTGGCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026898.1-542s1c1
Sequence:CCGGGAAATCAACTGTCTTTCATTACTCGAGTAATGAAAGACAGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-949s21c1
Sequence:CCGGTGAGCGAGAACTGGGATTTAACTCGAGTTAAATCCCAGTTCTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-487s21c1
Sequence:CCGGACTAGATGTCAGGTCTCTTAACTCGAGTTAAGAGACCTGACATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026898
WDR53 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 53
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026898.1-1198s1c1
Sequence:CCGGGATTCTGCCAAAGCTCGATATCTCGAGATATCGAGCTTTGGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-927s21c1
Sequence:CCGGTCAGGGTGATGGGAGTCAAATCTCGAGATTTGACTCCCATCACCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-869s21c1
Sequence:CCGGGTAGCGTCGTGCGGCAATATTCTCGAGAATATTGCCGCACGACGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-1198s21c1
Sequence:CCGGGATTCTGCCAAAGCTCGATATCTCGAGATATCGAGCTTTGGCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026898.1-542s1c1
Sequence:CCGGGAAATCAACTGTCTTTCATTACTCGAGTAATGAAAGACAGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-949s21c1
Sequence:CCGGTGAGCGAGAACTGGGATTTAACTCGAGTTAAATCCCAGTTCTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-487s21c1
Sequence:CCGGACTAGATGTCAGGTCTCTTAACTCGAGTTAAGAGACCTGACATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026898
WDR53 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 53
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026898.1-1198s1c1
Sequence:CCGGGATTCTGCCAAAGCTCGATATCTCGAGATATCGAGCTTTGGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-927s21c1
Sequence:CCGGTCAGGGTGATGGGAGTCAAATCTCGAGATTTGACTCCCATCACCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-869s21c1
Sequence:CCGGGTAGCGTCGTGCGGCAATATTCTCGAGAATATTGCCGCACGACGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-1198s21c1
Sequence:CCGGGATTCTGCCAAAGCTCGATATCTCGAGATATCGAGCTTTGGCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026898.1-542s1c1
Sequence:CCGGGAAATCAACTGTCTTTCATTACTCGAGTAATGAAAGACAGTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-949s21c1
Sequence:CCGGTGAGCGAGAACTGGGATTTAACTCGAGTTAAATCCCAGTTCTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026898.1-487s21c1
Sequence:CCGGACTAGATGTCAGGTCTCTTAACTCGAGTTAAGAGACCTGACATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks