EMAIL THIS PAGE TO A FRIEND

WDR54

WD repeat domain 54

UniProtKB ID: Q9H977, D6W5I3, Q53H85, Q86V45
Gene ID:
Mouse(75659) WD repeat domain 54
Rat(500226) WD repeat domain 54
naked mole-rat(101701340) WD repeat domain 54
domestic guinea pig(100713645) WD repeat domain 54
cow(511447) WD repeat domain 54
sheep(101106417) WD repeat domain 54
Zebrafish(445236) WD repeat domain 54
chicken(425870) WD repeat domain 54
domestic cat(101085114) WD repeat domain 54
dog(475789) WD repeat domain 54
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032118 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078531 MISSION® esiRNA esiRNA human WDR54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032118 Rosetta Predictions human pricing
NM_001109245 Rosetta Predictions rat pricing
NM_023790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012041 predicted 749
2 SASI_Hs01_00012042 predicted 510
3 SASI_Hs01_00012043 predicted 321
4 SASI_Hs01_00012045 predicted 759
5 SASI_Hs01_00012046 predicted 739
6 SASI_Hs01_00012047 predicted 771
7 SASI_Hs02_00359319 predicted 426
8 SASI_Hs01_00012048 predicted 235
9 SASI_Hs01_00012049 predicted 271
10 SASI_Hs01_00012050 predicted 849
11 SASI_Hs01_00012044 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246514 predicted 483
2 SASI_Rn02_00246515 predicted 1162
3 SASI_Rn02_00246516 predicted 542
4 SASI_Rn02_00246517 predicted 605
5 SASI_Rn02_00246518 predicted 1145
6 SASI_Rn02_00246519 predicted 454
7 SASI_Rn02_00246520 predicted 1067
8 SASI_Rn02_00246521 predicted 641
9 SASI_Rn02_00246522 predicted 1043
10 SASI_Rn02_00246523 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124269 predicted 544
2 SASI_Mm01_00124270 predicted 462
3 SASI_Mm01_00124271 predicted 729
4 SASI_Mm01_00124272 predicted 549
5 SASI_Mm01_00124273 predicted 530
6 SASI_Mm01_00124274 predicted 461
7 SASI_Mm01_00124275 predicted 468
8 SASI_Mm01_00124276 predicted 394
9 SASI_Mm01_00124277 predicted 783
10 SASI_Mm01_00124278 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023790
VALIDATED
WDR54 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 54
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-697s21c1
Sequence:CCGGAGACACCAATCACAGATATTGCTCGAGCAATATCTGTGATTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_023790.2-810s21c1
Sequence:CCGGTTCACCTTACTGACCCGAATACTCGAGTATTCGGGTCAGTAAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-478s21c1
Sequence:CCGGATCGAGGGATACAGATGTATGCTCGAGCATACATCTGTATCCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-565s21c1
Sequence:CCGGCTATGTTTGCCCGAGGAATTGCTCGAGCAATTCCTCGGGCAAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-505s21c1
Sequence:CCGGATGGCTCCGTCATGGTTTATTCTCGAGAATAAACCATGACGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023790.1-613s1c1
Sequence:CCGGGTCGAGTACTGGTCTTTGATACTCGAGTATCAAAGACCAGTACTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023790.1-242s1c1
Sequence:CCGGCCTGTCTAACAACCTCAGTGTCTCGAGACACTGAGGTTGTTAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023790
VALIDATED
WDR54 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 54
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-697s21c1
Sequence:CCGGAGACACCAATCACAGATATTGCTCGAGCAATATCTGTGATTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_023790.2-810s21c1
Sequence:CCGGTTCACCTTACTGACCCGAATACTCGAGTATTCGGGTCAGTAAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-478s21c1
Sequence:CCGGATCGAGGGATACAGATGTATGCTCGAGCATACATCTGTATCCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-565s21c1
Sequence:CCGGCTATGTTTGCCCGAGGAATTGCTCGAGCAATTCCTCGGGCAAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-505s21c1
Sequence:CCGGATGGCTCCGTCATGGTTTATTCTCGAGAATAAACCATGACGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023790.1-613s1c1
Sequence:CCGGGTCGAGTACTGGTCTTTGATACTCGAGTATCAAAGACCAGTACTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023790.1-242s1c1
Sequence:CCGGCCTGTCTAACAACCTCAGTGTCTCGAGACACTGAGGTTGTTAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023790
VALIDATED
WDR54 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 54
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-697s21c1
Sequence:CCGGAGACACCAATCACAGATATTGCTCGAGCAATATCTGTGATTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_023790.2-810s21c1
Sequence:CCGGTTCACCTTACTGACCCGAATACTCGAGTATTCGGGTCAGTAAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-478s21c1
Sequence:CCGGATCGAGGGATACAGATGTATGCTCGAGCATACATCTGTATCCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-565s21c1
Sequence:CCGGCTATGTTTGCCCGAGGAATTGCTCGAGCAATTCCTCGGGCAAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023790.2-505s21c1
Sequence:CCGGATGGCTCCGTCATGGTTTATTCTCGAGAATAAACCATGACGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023790.1-613s1c1
Sequence:CCGGGTCGAGTACTGGTCTTTGATACTCGAGTATCAAAGACCAGTACTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023790.1-242s1c1
Sequence:CCGGCCTGTCTAACAACCTCAGTGTCTCGAGACACTGAGGTTGTTAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032118
VALIDATED
WDR54 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain 54
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-761s1c1
Sequence:CCGGTGCATCTATATGAGGCCACTACTCGAGTAGTGGCCTCATATAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032118.2-919s1c1
Sequence:CCGGAGTGGCTACATTGAGGTGGAACTCGAGTTCCACCTCAATGTAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-322s1c1
Sequence:CCGGCTCACCTCACATCGAGGAATACTCGAGTATTCCTCGATGTGAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-653s1c1
Sequence:CCGGCAGGGCCAGAATTCACATTATCTCGAGATAATGTGAATTCTGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-549s1c1
Sequence:CCGGCCAGATGCCAATCACAGACATCTCGAGATGTCTGTGATTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032118
VALIDATED
WDR54 MISSION shRNA shRNA Plasmid DNA
WD repeat domain 54
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-761s1c1
Sequence:CCGGTGCATCTATATGAGGCCACTACTCGAGTAGTGGCCTCATATAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032118.2-919s1c1
Sequence:CCGGAGTGGCTACATTGAGGTGGAACTCGAGTTCCACCTCAATGTAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-322s1c1
Sequence:CCGGCTCACCTCACATCGAGGAATACTCGAGTATTCCTCGATGTGAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-653s1c1
Sequence:CCGGCAGGGCCAGAATTCACATTATCTCGAGATAATGTGAATTCTGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-549s1c1
Sequence:CCGGCCAGATGCCAATCACAGACATCTCGAGATGTCTGTGATTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032118
VALIDATED
WDR54 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain 54
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-761s1c1
Sequence:CCGGTGCATCTATATGAGGCCACTACTCGAGTAGTGGCCTCATATAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032118.2-919s1c1
Sequence:CCGGAGTGGCTACATTGAGGTGGAACTCGAGTTCCACCTCAATGTAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-322s1c1
Sequence:CCGGCTCACCTCACATCGAGGAATACTCGAGTATTCCTCGATGTGAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-653s1c1
Sequence:CCGGCAGGGCCAGAATTCACATTATCTCGAGATAATGTGAATTCTGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032118.2-549s1c1
Sequence:CCGGCCAGATGCCAATCACAGACATCTCGAGATGTCTGTGATTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks